My Album | Anatomy Showcase | Cell Showcase | Daily Showcase | Embryonic Showcase | Confocal Showcase | Retina Project

Search | Search for genes | Search Annotations | Track Progress | Order Mice & BACs | Cre Mice | About

Gene Progress Tracker, Sat May 18 10:55:35 EDT 2013 Gene name: transforming growth factor, beta 3 Symbol: Tgfb3 Alternative names: MGC118722, Tgfb-3

Jump to any stage of production for this gene 1. BGEM probe info (in situ hybridization) 2. GENSAT gene info 3. BAC Modification & availability 4. Deployment of images to www.gensat.org 5. MMRRC Production: availability of founder lines

1. BGEM probe info (in situ hybridization)

BGEM, total: 1


Probe	aliases	In Situ Run	LinkToBGEM
Tgfb3	MGC118722, Tgfb-3	7/5/2005	3187

2. GENSAT gene info

Gene Support Comment:

Two BAC lines have overlapping expression at P7. The BAC data is consistent with the literature. EGFP expression is detected in both neurons and glia. The E15-5 BAC data grossly matches E14-5 BAC data from Genepaint.org.

Current literature references:

PubMed ID
1754055
1538124
8753879

3. BAC Modification & availability

Modified BACs, total available: 1

BAC	marker	address	A-homology arm (A-box) 3' Primer	A-homology arm (A-box) 5' Primer	Availability
BX2274	EGFP	RP23-235H2	CTTCATGTGTGAGCCCAGGAACGAGGC	GGCGCGCCTGGGACCCAGCCATCCTCTTCTGCAC	Date marked for shipping: 2010-06-01 Shipped? Y Available from CHORI? BX2274

4. Deployment of images to www.gensat.org

Batches of images deployed to www.gensat.org, total: 6


age	acquisition technique	orientation	CNS region	Founder Line	Marker	fluorescent?	images
adult	brightfield	Sagittal	Brain	NG133	EGFP	Y	10 images
adult	brightfield	Horizontal	Spinal cord	NG133	EGFP	Y	2 images
P7	brightfield	Sagittal	Brain	NG133	EGFP	Y	11 images
P7	brightfield	Horizontal	Spinal cord	NG133	EGFP	Y	3 images
E15.5	brightfield	Sagittal	Brain	NG133	EGFP	Y	10 images
E15.5	brightfield	Horizontal	Spinal cord	NG133	EGFP	Y	3 images


See all 6 batches of images on gensat.org

5. MMRRC Production: availability of founder lines

MMRRC Availability:

strain	Available date	availability	Available products	Founder Expression Comment
STOCK Tg(Tgfb3-EGFP)NG133Gsat/Mmucd: Details, Order	2011-12-08	Cryo-archive	Mice, Sperm	-

top

Search for another gene:

Or use gene selection list:

0710001E13Rik ( RIKEN cDNA 0710001E13 gene ) 1110008P14Rik ( RIKEN cDNA 1110008P14 gene ) 1110032E23Rik ( RIKEN cDNA 1110032E23 gene ) 1200009O22Rik ( RIKEN cDNA 1200009O22 gene ) 1500041N16Rik ( RIKEN cDNA 1500041N16 gene ) 1700010C24Rik ( RIKEN cDNA 1700010C24 gene ) 1700019N12Rik ( RIKEN cDNA 1700019N12 gene ) 1700021K02Rik ( RIKEN cDNA 1700021K02 gene ) 1700021K19Rik ( RIKEN cDNA 1700021K19 gene ) 1700027J05Rik ( RIKEN cDNA 1700027J05 gene ) 1700051I12Rik ( RIKEN cDNA 1700051I12 gene ) 1810041L15Rik ( RIKEN cDNA 1810041L15 gene ) 2010300C02Rik ( RIKEN cDNA 2010300C02 gene ) 2210419I08Rik ( RIKEN cDNA 2210419I08 gene ) 2310010M24Rik ( RIKEN cDNA 2310010M24 gene ) 2310022K01Rik ( RIKEN cDNA 2310022K01 gene ) 2310045A20Rik ( RIKEN cDNA 2310045A20 gene ) 2310046K01Rik ( RIKEN cDNA 2310046K01 gene ) 2410002F23Rik ( RIKEN cDNA 2410002F23 gene ) 2410018L13Rik ( RIKEN cDNA 2410018L13 gene ) 2410066E13Rik ( RIKEN cDNA 2410066E13 gene ) 2610200G18Rik ( RIKEN cDNA 2610200G18 gene ) 3110035E14Rik ( RIKEN cDNA 3110035E14 gene ) 3110047P20Rik ( RIKEN cDNA 3110047P20 gene ) 3632451O06Rik ( RIKEN cDNA 3632451O06 gene ) 4632404H22Rik ( RIKEN cDNA 4632404H22 gene ) 4930555G01Rik ( RIKEN cDNA 4930555G01 gene ) 4932418E24Rik ( RIKEN cDNA 4932418E24 gene ) 4933426K21Rik ( RIKEN cDNA 4933426K21 gene ) 5430405G05Rik ( RIKEN cDNA 5430405G05 gene ) 5430432M24Rik ( RIKEN cDNA 5430432M24 gene ) 6330403A02Rik ( RIKEN cDNA 6330403A02 gene ) 6330407J23Rik ( RIKEN cDNA 6330407J23 gene ) 6330514A18Rik ( RIKEN cDNA 6330514A18 gene ) 6430573F11Rik ( RIKEN cDNA 6430573F11 gene ) 8430419L09Rik ( RIKEN cDNA 8430419L09 gene ) 9130024F11Rik ( RIKEN cDNA 9130024F11 gene ) 9130213B05 ( RIKEN cDNA 9130213B05 gene ) 9230117N10Rik ( RIKEN cDNA 9230117N10 gene ) 9330175B01Rik ( RIKEN cDNA 9330175B01 gene ) 9430020K01Rik ( RIKEN cDNA 9430020K01 gene ) 9630033F20Rik ( RIKEN cDNA 9630033F20 gene ) 9930013L23Rik ( RIKEN cDNA 9930013L23 gene ) A230065H16Rik ( RIKEN cDNA A230065H16 gene ) A2bp1 ( ataxin 2 binding protein 1 ) A330102H22Rik ( RIKEN cDNA A330102H22 gene ) A330104H05Rik ( RIKEN cDNA A330104H05 gene ) A830010M20Rik ( RIKEN cDNA A830010M20 gene ) A830029E22Rik ( RIKEN cDNA A830029E22 gene ) A930025D01Rik ( RIKEN cDNA A930025D01 gene ) Aatf ( apoptosis antagonizing transcription factor ) Abat ( 4-aminobutyrate aminotransferase ) Abcb1a ( ATP-binding cassette, sub-family B (MDR/TAP), member 1A ) Abcb1b ( ATP-binding cassette, sub-family B (MDR/TAP), member 1B ) Abcb6 ( ATP-binding cassette, sub-family B (MDR/TAP), member 6 ) Abcc9 ( ATP-binding cassette, sub-family C (CFTR/MRP), member 9 ) Abhd3 ( abhydrolase domain containing 3 ) Abhd4 ( abhydrolase domain containing 4 ) Abhd5 ( abhydrolase domain containing 5 ) Abhd6 ( abhydrolase domain containing 6 ) Abl2 ( v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) ) Ablim1 ( actin-binding LIM protein 1 ) Ablim2 ( actin-binding LIM protein 2 ) Abracl ( ABRA C-terminal like ) Acaa2 ( acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) ) Acadl ( acyl-Coenzyme A dehydrogenase, long-chain ) Accn1 ( amiloride-sensitive cation channel 1, neuronal (degenerin) ) Ace ( angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 ) Ache ( acetylcholinesterase ) Aco2 ( aconitase 2, mitochondrial ) Acsbg1 ( acyl-CoA synthetase bubblegum family member 1 ) Actb ( actin, beta ) Acvr1c ( activin A receptor, type IC ) Acvr2a ( activin receptor IIA ) Acvrl1 ( activin A receptor, type II-like 1 ) Adam11 ( a disintegrin and metallopeptidase domain 11 ) Adam23 ( a disintegrin and metallopeptidase domain 23 ) Adamts19 ( a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19 ) Adamts2 ( a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2 ) Adamts8 ( a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8 ) Adarb1 ( adenosine deaminase, RNA-specific, B1 ) Adcy1 ( adenylate cyclase 1 ) Adcy2 ( adenylate cyclase 2 ) Adcy5 ( adenylate cyclase 5 ) Adcy8 ( adenylate cyclase 8 ) Adcy9 ( adenylate cyclase 9 ) Adcyap1 ( adenylate cyclase activating polypeptide 1 ) Adk ( adenosine kinase ) Adora2a ( adenosine A2a receptor ) Adra1a ( adrenergic receptor, alpha 1a ) Adra1d ( adrenergic receptor, alpha 1d ) Adra2a ( adrenergic receptor, alpha 2a ) Adra2c ( adrenergic receptor, alpha 2c ) AF529169 ( cDNA sequence AF529169 ) Aff3 ( AF4/FMR2 family, member 3 ) Agrp ( agouti related protein ) Agt ( angiotensinogen (serpin peptidase inhibitor, clade A, member 8) ) Agtpbp1 ( ATP/GTP binding protein 1 ) Agtr1a ( angiotensin II receptor, type 1a ) Agtr2 ( angiotensin II receptor, type 2 ) Agxt2l1 ( alanine-glyoxylate aminotransferase 2-like 1 ) Ahi1 ( Abelson helper integration site ) Ahnak2 ( AHNAK nucleoprotein 2 ) AI317237 ( expressed sequence AI317237 ) AI427515 ( expressed sequence AI427515 ) AI507211 ( expressed sequence AI507211 ) AI593442 ( expressed sequence AI593442 ) AI606473 ( expressed sequence AI606473 ) AI790298 ( espressed sequence A1790298 ) AI836003 ( expressed sequence AI836003 ) AI849226 ( expressed sequence AI849226 ) Ajap1 ( adherens junction associated protein 1 ) Ak4 ( adenylate kinase 4 ) Akap12 ( A kinase (PRKA) anchor protein (gravin) 12 ) Akap5 ( A kinase (PRKA) anchor protein 5 ) Akap9 ( A kinase (PRKA) anchor protein (yotiao) 9 ) Akr1c18 ( aldo-keto reductase family 1, member C18 ) Akt3 ( thymoma viral proto-oncogene 3 ) Aldh1a1 ( aldehyde dehydrogenase family 1, subfamily A1 ) Aldh1l1 ( aldehyde dehydrogenase 1 family, member L1 ) Aldh7a1 ( aldehyde dehydrogenase family 7, member A1 ) Aldoc ( aldolase C, fructose-bisphosphate ) Alg2 ( asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase) ) Alk ( anaplastic lymphoma kinase ) Als2 ( amyotrophic lateral sclerosis 2 (juvenile) ) Amfr ( autocrine motility factor receptor ) Amigo1 ( adhesion molecule with Ig like domain 1 ) Amigo2 ( adhesion molecule with Ig like domain 2 ) Angpt2 ( angiopoietin 2 ) Ank ( progressive ankylosis ) Ank1 ( ankyrin 1, erythroid ) Ank2 ( ankyrin 2, brain ) Ankrd34b ( ankyrin repeat domain 34B ) Ankrd43 ( ankyrin repeat domain 43 ) Anxa2 ( annexin A2 ) Anxa4 ( annexin A4 ) Anxa5 ( annexin A5 ) Ap2b1 ( adaptor-related protein complex 2, beta 1 subunit ) Apba1 ( amyloid beta (A4) precursor protein binding, family A, member 1 ) Api5 ( apoptosis inhibitor 5 ) Apod ( apolipoprotein D ) Apoe ( apolipoprotein E ) App ( amyloid beta (A4) precursor protein ) Aqp4 ( aquaporin 4 ) Ar ( androgen receptor ) Arc ( activity regulated cytoskeletal-associated protein ) Arf6 ( ADP-ribosylation factor 6 ) Arhgap25 ( Rho GTPase activating protein 25 ) Arhgap33 ( Rho GTPase activating protein 33 ) Arhgap5 ( Rho GTPase activating protein 5 ) Arhgdib ( Rho, GDP dissociation inhibitor (GDI) beta ) Arhgdig ( Rho GDP dissociation inhibitor (GDI) gamma ) Arhgef17 ( Rho guanine nucleotide exchange factor (GEF) 17 ) Arhgef6 ( Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 ) Arhgef7 ( Rho guanine nucleotide exchange factor (GEF7) ) Arl4c ( ADP-ribosylation factor-like 4C ) Arl6ip1 ( ADP-ribosylation factor-like 6 interacting protein 1 ) Arntl ( aryl hydrocarbon receptor nuclear translocator-like ) Arpp21 ( cyclic AMP-regulated phosphoprotein, 21 ) Artn ( artemin ) Arvcf ( armadillo repeat gene deleted in velo-cardio-facial syndrome ) Arx ( aristaless related homeobox ) Asb4 ( ankyrin repeat and SOCS box-containing 4 ) Ascl1 ( achaete-scute complex homolog 1 (Drosophila) ) Asic4 ( acid-sensing (proton-gated) ion channel family member 4 ) Aspm ( asp (abnormal spindle)-like, microcephaly associated (Drosophila) ) Astn1 ( astrotactin 1 ) Astn2 ( astrotactin 2 ) Atg4c ( autophagy related 4C, cysteine peptidase ) Atic ( 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase ) Atm ( ataxia telangiectasia mutated homolog (human) ) Atn1 ( atrophin 1 ) Atoh1 ( atonal homolog 1 (Drosophila) ) Atoh4 ( atonal homolog 4 ) Atp1a1 ( ATPase, Na+/K+ transporting, alpha 1 polypeptide ) Atp1b1 ( ATPase, Na+/K+ transporting, beta 1 polypeptide ) Atp2a2 ( ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 ) Atp5a1 ( ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1 ) Atp5j2 ( ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2 ) Atp6v1b2 ( ATPase, H+ transporting, lysosomal V1 subunit B2 ) Atp8b3 ( ATPase, Class I, type 8B, member 3 ) Atpif1 ( ATPase inhibitory factor 1 ) Atxn1 ( ataxin 1 ) Auts2 ( autism susceptibility candidate 2 ) Auxillin ( Auxillin gene ) Avil ( advillin ) Avp ( arginine vasopressin ) Avpr1a ( arginine vasopressin receptor 1A ) Avpr1b ( arginine vasopressin receptor 1B ) B2m ( beta-2 microglobulin ) B3galt2 ( UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 ) B3gat1 ( beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) ) B3gat2 ( beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) ) B430201A12Rik ( RIKEN cDNA B430201A12 gene ) Bace1 ( beta-site APP cleaving enzyme 1 ) Bace2 ( beta-site APP-cleaving enzyme 2 ) Bahcc1 ( BAH domain and coiled-coil containing 1 ) Baiap2 ( brain-specific angiogenesis inhibitor 1-associated protein 2 ) Baiap3 ( BAI1-associated protein 3 ) Bambi ( BMP and activin membrane-bound inhibitor, homolog (Xenopus laevis) ) Barhl1 ( BarH-like 1 (Drosophila) ) Basp1 ( brain abundant, membrane attached signal protein 1 ) Baz2a ( bromodomain adjacent to zinc finger domain, 2A ) BC005537 ( cDNA sequence BC005537 ) Bcan ( brevican ) Bcar1 ( breast cancer anti-estrogen resistance 1 ) Bcat1 ( branched chain aminotransferase 1, cytosolic ) Bcl11b ( B-cell leukemia/lymphoma 11B ) Bcl2l11 ( BCL2-like 11 (apoptosis facilitator) ) Bcl2l2 ( Bcl2-like2 ) Bcl6 ( B-cell leukemia/lymphoma 6 ) BCL6B ( B-cell CLL/lymphoma 6, member B ) Bdnf ( brain derived neurotrophic factor ) Beclin ( Beclin ) Becn1 ( beclin 1, autophagy related ) Bend5 ( BEN domain containing 5 ) Bend6 ( BEN domain containing 6 ) Bhlhe22 ( basic helix-loop-helix family, member e22 ) Bhlhe40 ( basic helix-loop-helix family, member e40 ) Bhlhe41 ( basic helix-loop-helix family, member e41 ) Birc1a ( baculoviral IAP repeat-containing 1a ) Bmi1 ( B lymphoma Mo-MLV insertion region 1 ) Bmp1 ( bone morphogenetic protein 1 ) Bmp3 ( bone morphogenetic protein 3 ) Bmp4 ( bone morphogenetic protein 4 ) Bmp6 ( bone morphogenetic protein 6 ) Bmp7 ( bone morphogenetic protein 7 ) Bmpr1a ( bone morphogenetic protein receptor, type 1A ) Bnip3 ( BCL2/adenovirus E1B interacting protein 3 ) Bok ( Bcl-2-related ovarian killer protein ) Brca1 ( breast cancer 1 ) Bsx ( brain specific homeobox ) Btbd14a ( BTB (POZ) domain containing 14A ) Btbd17 ( BTB (POZ) domain containing 17 ) Btbd3 ( BTB (POZ) domain containing 3 ) Btg1 ( B cell translocation gene 1, anti-proliferative ) Btg2 ( B cell translocation gene 2, anti-proliferative ) Btg3 ( B cell translocation gene 3 ) Bubblegum ( Bubblegum ) C030003D03Rik ( RIKEN cDNA C030003D03 gene ) C130021I20Rik ( Riken cDNA C130021I20 gene ) C130060K24Rik ( RIKEN cDNA C130060K24 gene ) C1ql2 ( complement component 1, q subcomponent-like 2 ) C1ql3 ( C1q-like 3 ) C230001G10 ( Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230001G10 product:unknown EST, full insert sequence. ) C2cd2l ( C2 calcium-dependent domain containing 2-like ) C330002I19Rik ( RIKEN cDNA C330002I19 gene ) C330027C09Rik ( RIKEN cDNA C330027C09 gene ) C630035N08Rik ( RIKEN cDNA C630035N08 gene ) C730048E16Rik ( RIKEN cDNA C730048E16 gene ) C79127 ( expressed sequence C79127 ) Cables1 ( CDK5 and Abl enzyme substrate 1 ) Cabp7 ( calcium binding protein 7 ) Cachd1 ( cache domain containing 1 ) Cacna1g ( calcium channel, voltage-dependent, T type, alpha 1G subunit ) Cacna1h ( calcium channel, voltage-dependent, T type, alpha 1H subunit ) Cacna1i ( calcium channel, voltage-dependent, alpha 1I subunit ) Cacna2d1 ( calcium channel, voltage-dependent, alpha2/delta subunit 1 ) Cacnb1 ( calcium channel, voltage-dependent, beta 1 subunit ) Cacnb4 ( calcium channel, voltage-dependent, beta 4 subunit ) Cacng3 ( calcium channel, voltage-dependent, gamma subunit 3 ) Cacng5 ( calcium channel, voltage-dependent, gamma subunit 5 ) Cacng7 ( calcium channel, voltage-dependent, gamma subunit 7 ) Cacng8 ( calcium channel, voltage-dependent, gamma subunit 8 ) Cadm1 ( Cell adhesion molecule 1 ) Cadps ( Ca2+-dependent secretion activator ) Cadps2 ( Ca2+-dependent activator protein for secretion 2 ) Calb1 ( calbindin 1 ) Calb2 ( calbindin 2 ) Calbmut ( Calbindin-mut PCE1 ) Calca ( calcitonin/calcitonin-related polypeptide, alpha ) Calcb ( calcitonin-related polypeptide, beta ) Calcr ( calcitonin receptor ) Calm2 ( calmodulin 2 ) Caln1 ( calneuron 1 ) Calu ( calumenin ) Camk1d ( calcium/calmodulin-dependent protein kinase ID ) Camk1g ( calcium/calmodulin-dependent protein kinase I gamma ) Camk2a ( calcium/calmodulin-dependent protein kinase II alpha ) Camk2d ( calcium/calmodulin-dependent protein kinase II, delta ) Camk2g ( calcium/calmodulin-dependent protein kinase II gamma ) Camk4 ( calcium/calmodulin-dependent protein kinase IV ) Camkk1 ( calcium/calmodulin-dependent protein kinase kinase 1, alpha ) Camkk2 ( calcium/calmodulin-dependent protein kinase kinase 2, beta ) Camkv ( CaM kinase-like vesicle-associated ) Cap2 ( CAP, adenylate cyclase-associated protein, 2 (yeast) ) Capn3 ( calpain 3 ) Capns1 ( calpain, small subunit 1 ) Car11 ( carbonic anhydrase 11 ) Car12 ( carbonic anyhydrase 12 ) Car3 ( carbonic anhydrase 3 ) Car8 ( carbonic anhydrase 8 ) Card6 ( caspase recruitment domain family, member 6 ) Cartpt ( CART prepropeptide ) Cask ( calcium/calmodulin-dependent serine protein kinase (MAGUK family) ) Casp8 ( caspase 8 ) Casp9 ( caspase 9 ) Casr ( calcium-sensing receptor ) Cbfa2t3h ( core-binding factor, runt domain, alpha subunit 2; translocated to, 3 homolog (human) ) Cbln1 ( cerebellin 1 precursor protein ) Cbln2 ( cerebellin 2 precursor protein ) Cbln3 ( cerebellin 3 precursor protein ) Cbln4 ( cerebellin 4 precursor protein ) Cbx5 ( chromobox 5 ) Ccdc163 ( coiled-coil domain containing 163 ) Ccdc3 ( coiled-coil domain containing 3 ) Cck ( cholecystokinin ) Cckar ( cholecystokinin A receptor ) Cckbr ( cholecystokinin B receptor ) Ccna2 ( cyclin A2 ) Ccnd1 ( cyclin D1 ) Ccnd2 ( cyclin D2 ) Ccne1 ( cyclin E1 ) Ccne2 ( cyclin E2 ) Ccsap ( centriole, cilia and spindle associated protein ) Cd200 ( Cd200 antigen ) Cd200r1 ( CD200 receptor 1 ) CD209a ( CD209a antigen ) Cd247 ( CD247 antigen ) Cd24a ( CD24a antigen ) Cd34 ( CD34 antigen ) Cd4 ( CD4 antigen ) Cd47 ( CD47 antigen (Rh-related antigen, integrin-associated signal transducer) ) Cd63 ( CD63 antigen ) Cd68 ( CD68 antigen ) Cd82 ( CD82 antigen ) Cdc27 ( cell division cycle 27 ) Cdc42bpg ( CDC42 binding protein kinase gamma (DMPK-like) ) Cdc42ep4 ( CDC42 effector protein (Rho GTPase binding) 4 ) Cdc45 ( cell division cycle 45 ) Cdc6 ( cell division cycle 6 ) Cdh1 ( cadherin 1 ) Cdh10 ( cadherin 10 ) Cdh11 ( cadherin 11 ) Cdh13 ( cadherin 13 ) Cdh2 ( cadherin 2 ) Cdh20 ( cadherin 20 ) Cdh23 ( cadherin 23 (otocadherin) ) Cdh24 ( cadherin-like 24 ) Cdh3 ( cadherin 3 ) Cdh4 ( cadherin 4 ) Cdh6 ( cadherin 6 ) Cdh8 ( cadherin 8 ) Cdh9 ( cadherin 9 ) Cdhr1 ( cadherin-related family member 1 ) Cdk17 ( cyclin-dependent kinase 17 ) Cdk4 ( cyclin-dependent kinase 4 ) Cdk5 ( cyclin-dependent kinase 5 ) Cdk5r1 ( cyclin-dependent kinase 5, regulatory subunit 1 (p35) ) Cdk5r2 ( cyclin-dependent kinase 5, regulatory subunit 2 (p39) ) Cdk5rap2 ( CDK5 regulatory subunit associated protein 2 ) Cdk6 ( cyclin-dependent kinase 6 ) Cdkn1a ( cyclin-dependent kinase inhibitor 1A (P21) ) Cdkn1b ( cyclin-dependent kinase inhibitor 1B ) Cdkn1c ( cyclin-dependent kinase inhibitor 1C (P57) ) Cdkn2a ( cyclin-dependent kinase inhibitor 2A ) Cdkn2c ( cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) ) Cdkn2d ( cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) ) Cdon ( cell adhesion molecule-related/down-regulated by oncogenes ) Cdr2 ( cerebellar degeneration-related 2 ) Celf6 ( CUGBP, Elav-like family member 6 ) Cep290 ( centrosomal protein 290 ) Cerk ( ceramide kinase ) Cfh ( complement component factor h ) Cgrp ( calcitonin gene-related peptide ) Chat ( choline acetyltransferase ) Chd7 ( chromodomain helicase DNA binding protein 7 ) Chgb ( chromogranin B ) Chl1 ( cell adhesion molecule with homology to L1CAM ) Chn1 ( chimerin (chimaerin) 1 ) Chn2 ( chimerin (chimaerin) 2 ) Chordc1 ( cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1 ) Chrd ( chordin ) Chrm1 ( cholinergic receptor, muscarinic 1, CNS ) Chrm2 ( cholinergic receptor, muscarinic 2, cardiac ) Chrm3 ( cholinergic receptor, muscarinic 3, cardiac ) Chrm4 ( cholinergic receptor, muscarinic 4 ) Chrm5 ( cholinergic receptor, muscarinic 5 ) Chrna2 ( cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal) ) Chrna3 ( cholinergic receptor, nicotinic, alpha polypeptide 3 ) Chrna4 ( cholinergic receptor, nicotinic, alpha polypeptide 4 ) Chrna5 ( cholinergic receptor, nicotinic, alpha polypeptide 5 ) Chrna6 ( cholinergic receptor, nicotinic, alpha polypeptide 6 ) Chrna7 ( cholinergic receptor, nicotinic, alpha polypeptide 7 ) Chrna9 ( cholinergic receptor, nicotinic, alpha polypeptide 9 ) Chrnb2 ( cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal) ) Chrnb3 ( cholinergic receptor, nicotinic, beta polypeptide 3 ) Chrnb4 ( cholinergic receptor, nicotinic, beta polypeptide 4 ) Chst15 ( carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 ) Chst2 ( carbohydrate sulfotransferase 2 ) Chst8 ( carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 ) Cic ( capicua homolog (Drosophila) ) Cisd1 ( CDGSH iron sulfur domain 1 ) Cit ( citron ) Cited1 ( Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 ) Cited2 ( Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 ) Ckb ( creatine kinase, brain ) Ckm ( creatine kinase, muscle ) Ckmt1 ( creatine kinase, mitochondrial 1, ubiquitous ) Clca3 ( chloride channel calcium activated 3 ) Clcn1 ( chloride channel 1 ) Clcn5 ( chloride channel 5 ) Cldn1 ( claudin 1 ) Cldn2 ( claudin 2 ) Cldn5 ( claudin 5 ) Clic5 ( chloride intracellular channel 5 ) Clic6 ( chloride intracellular channel 6 ) Clock ( circadian locomotor output cycles kaput ) Clptm1l ( CLPTM1-like ) Clu ( clusterin ) Clvs2 ( clavesin 2 ) Cmas ( cytidine monophospho-N-acetylneuraminic acid synthetase ) Cmbl ( carboxymethylenebutenolidase-like (Pseudomonas) ) Cmtm5 ( CKLF-like MARVEL transmembrane domain containing 5 ) Cnga2 ( cyclic nucleotide gated channel alpha 2 ) Cnnm2 ( cyclin M2 ) Cnp ( 2,3-cyclic nucleotide 3 phosphodiesterase ) Cnr1 ( cannabinoid receptor 1 (brain) ) Cntf ( ciliary neurotrophic factor ) Cntfr ( ciliary neurotrophic factor receptor ) Cntn1 ( contactin 1 ) Cntn2 ( contactin 2 ) Cntn3 ( contactin 3 ) Cntn6 ( contactin 6 ) Cntnap1 ( contactin associated protein-like 1 ) Cntnap2 ( contactin associated protein-like 2 ) Coch ( coagulation factor C homolog (Limulus polyphemus) ) Col12a1 ( procollagen, type XII, alpha 1 ) Col18a1 ( collagen, type XVIII, alpha 1 ) Col1a1 ( collagen, type I, alpha 1 ) col24a1 ( procollagen, type XXIV, alpha 1 ) Col25a1 ( procollagen, type XXV, alpha 1 ) Col3a1 ( collagen, type III, alpha 1 ) Col6a1 ( collagen, type VI, alpha 1 ) Col9a1 ( procollagen, type IX, alpha 1 ) Col9a3 ( procollagen, type IX, alpha 3 ) Colgalt2 ( collagen beta(1-O)galactosyltransferase 2 ) Comp ( cartilage oligomeric matrix protein ) Comt ( catechol-O-methyltransferase ) Cort ( cortistatin ) Cox4i1 ( Cytochrome c oxidase subunit IV isoform 1 ) Cox6a2 ( Cytochrome c oxidase, subunit VI a, polypeptide 2 ) Cox7a2 ( cytochrome c oxidase, subunit VIIa 2 ) Cpe ( carboxypeptidase E ) Cpeb3 ( cytoplasmic polyadenylation element binding protein 3 ) Cplx1 ( complexin 1 ) Cplx3 ( complexin 3 ) Cpne5 ( copine V ) Cpne6 ( copine VI ) Cpne7 ( copine VII ) Cpt1a ( carnitine palmitoyltransferase 1a, liver ) Crabp1 ( cellular retinoic acid binding protein I ) Creb1 ( cAMP responsive element binding protein 1 ) Crh ( corticotropin releasing hormone ) Crhr1 ( corticotropin releasing hormone receptor 1 ) Crhr2 ( corticotropin releasing hormone receptor 2 ) Crim1 ( cysteine rich transmembrane BMP regulator 1 (chordin like) ) Crip2 ( cysteine rich protein 2 ) Crk ( v-crk sarcoma virus CT10 oncogene homolog (avian) ) Crkl ( v-crk sarcoma virus CT10 oncogene homolog (avian)-like ) Crlf1 ( cytokine receptor-like factor 1 ) Crxos1 ( EST AA606869 ) Cryab ( crystallin, alpha B ) Crym ( crystallin, mu ) Csdc2 ( cold shock domain containing C2, RNA binding ) Csf2rb2 ( colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage) ) Csnk1d ( casein kinase 1, delta ) Csnk1e ( casein kinase 1, epsilon ) Csnk1g1 ( casein kinase 1, gamma 1 ) Csnk1g3 ( casein kinase 1, gamma 3 ) Cst3 ( cystatin C ) Ctgf ( connective tissue growth factor ) Ctnna1 ( catenin (cadherin associated protein), alpha 1 ) Ctnnb1 ( catenin (cadherin associated protein), beta 1 ) Ctnnd1 ( catenin (cadherin associated protein), delta 1 ) Ctsk ( cathepsin K ) Ctxn1 ( cortexin 1 ) Cugbp2 ( CUG triplet repeat, RNA binding protein 2 ) Cux1 ( cut-like homeobox 1 ) Cux2 ( cut-like homeobox 2 ) Cx3cl1 ( chemokine (C-X3-C motif) ligand 1 ) Cx3cr1 ( chemokine (C-X3-C) receptor 1 ) Cxcl11 ( chemokine (C-X-C motif) ligand 11 ) Cxcl12 ( chemokine (C-X-C motif) ligand 12 ) Cxcl12duplicate ( Cxcl12 duplicate ) Cxcl13 ( chemokine (C-X-C motif) ligand 13 ) Cxcl14 ( chemokine (C-X-C motif) ligand 14 ) Cxcr4 ( chemokine (C-X-C motif) receptor 4 ) Cxcr7 ( chemokine (C-X-C motif) receptor 7 ) Cxxc4 ( CXXC finger 4 ) Cyb561 ( cytochrome b-561 ) Cyfip2 ( cytoplasmic FMR1 interacting protein 2 ) Cyld ( cylindromatosis (turban tumor syndrome) ) Cyp11a1 ( cytochrome P450, family 11, subfamily a, polypeptide 1 ) Cyp19a1 ( cytochrome P450, family 19, subfamily a, polypeptide 1 ) Cyp26b1 ( cytochrome P450, family 26, subfamily b, polypeptide 1 ) Cyp39a1 ( cytochrome P450, family 39, subfamily a, polypeptide 1 ) Cyp4v3 ( cytochrome P450, family 4, subfamily v, polypeptide 3 ) Cyp7b1 ( cytochrome P450, family 7, subfamily b, polypeptide 1 ) Cyr61 ( cysteine rich protein 61 ) D14Ertd171e ( DNA segment, Chr 14, ERATO Doi 171, expressed ) D330050I23Rik ( RIKEN cDNA D330050I23 gene ) D630045J12Rik ( RIKEN cDNA D630045J12 gene ) D6Wsu176e ( DNA segment, Chr 6, Wayne State University 176, expressed ) D8Ertd738e ( DNA segment, Chr 8, ERATO Doi 738, expressed ) D930035P11 ( Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:D930035P11 product:unknown EST, full insert sequence ) Dab1 ( disabled homolog 1 (Drosophila) ) Dact2 ( dapper homolog 2, antagonist of beta-catenin (xenopus) ) Dap ( death-associated protein ) Dap3 ( death associated protein 3 ) Darc ( Duffy blood group, chemokine receptor ) Dbh ( dopamine beta hydroxylase ) Dbi ( diazepam binding inhibitor ) Dbp ( D site albumin promoter binding protein ) Dbx1 ( developing brain homeobox 1 ) Dbx2 ( developing brain homeobox 2 ) Dcc ( deleted in colorectal carcinoma ) Dcdc2a ( doublecortin domain containing 2a ) Dcdc5 ( doublecortin domain containing 5 ) Dclk1 ( doublecortin-like kinase 1 ) Dclk3 ( doublecortin-like kinase 3 ) Dcn ( decorin ) Dct ( dopachrome tautomerase ) Dctn1 ( dynactin 1 ) Dcx ( doublecortin ) Ddc ( dopa decarboxylase ) Ddc8 ( testis specific protein, Ddc8 ) Ddit4l ( DNA-damage-inducible transcript 4-like ) Ddr1 ( discoidin domain receptor family, member 1 ) Ddr2 ( discoidin domain receptor family, member 2 ) Depdc6 ( DEP domain containing 6 ) Dgcr14 ( DiGeorge syndrome critical region gene 14 ) Dgcr6 ( DiGeorge syndrome critical region gene 6 ) Dgcr8 ( DiGeorge syndrome critical region gene 8 ) Dgkb ( diacylglycerol kinase, beta ) Dgkh ( diacylglycerol kinase, eta ) Dhcr24 ( 24-dehydrocholesterol reductase ) Dhrs3 ( dehydrogenase/reductase (SDR family) member 3 ) Dhx57 ( DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 ) diap3 ( diaphanous homolog 3 (Drosophila) ) Dkk3 ( dickkopf homolog 3 (Xenopus laevis) ) Dld ( dihydrolipoamide dehydrogenase ) Dlg1 ( discs, large homolog 1 (Drosophila) ) Dlg2 ( discs, large homolog 2 (Drosophila) ) Dlg3 ( discs, large homolog 3 (Drosophila) ) Dlg4 ( discs, large homolog 4 (Drosophila) ) Dlgap1 ( discs, large (Drosophila) homolog-associated protein 1 ) Dlgap2 ( discs, large (Drosophila) homolog-associated protein 2 ) Dlk1 ( delta-like 1 homolog (Drosophila) ) Dll1 ( delta-like 1 (Drosophila) ) Dlx1 ( distal-less homeobox 1 ) Dlx2 ( distal-less homeobox 2 ) Dlx3 ( distal-less homeobox 3 ) Dlx5 ( distal-less homeobox 5 ) Dlx6 ( distal-less homeobox 6 ) Dmbx1 ( diencephalon/mesencephalon homeobox 1 ) Dmrt3 ( Doublesex and mab-3 transcription factor 3 ) Dmtf1 ( cyclin D binding myb-like transcription factor 1 ) Dnajb1 ( DnaJ (Hsp40) homolog, subfamily B, member 1 ) Dnajc12 ( DnaJ (Hsp40) homolog, subfamily C, member 12 ) Dnalc4 ( dynein, axonemal, light chain 4 ) Dner ( delta/notch-like EGF-related receptor ) Dnm2 ( dynamin 2 ) Dnmt1 ( DNA methyltransferase (cytosine-5) 1 ) Dnmt3a ( DNA methyltransferase 3A ) Doc2a ( double C2, alpha ) Doc2b ( double C2, beta ) Doc2g ( double C2, gamma ) Dock10 ( dedicator of cytokinesis 10 ) Dock7 ( dedicator of cytokinesis 7 ) Dok5 ( docking protein 5 ) Dpp10 ( dipeptidylpeptidase 10 ) Dpysl3 ( dihydropyrimidinase-like 3 ) Dpysl5 ( dihydropyrimidinase-like 5 ) Drd1a ( dopamine receptor D1A ) Drd2 ( dopamine receptor D2 ) Drd3 ( dopamine receptor D3 ) Drd4 ( dopamine receptor D4 ) Drd5 ( dopamine receptor D5 ) Dsp ( desmoplakin ) Dtna ( dystrobrevin alpha ) Dtx4 ( deltex 4 homolog (Drosophila) ) Dtymk ( deoxythymidylate kinase ) Dusp1 ( dual specificity phosphatase 1 ) Dusp14 ( dual specificity phosphatase 14 ) Dusp16 ( dual specificity phosphatase 16 ) Dusp3 ( dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) ) Dusp5 ( dual specificity phosphatase 5 ) Dusp6 ( dual specificity phosphatase 6 ) Dynll1 ( dynein light chain LC8-type 1 ) Dyrk1a ( dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a ) Dyx1c1 ( dyslexia susceptibility 1 candidate 1 homolog (human) ) Dzip1 ( DAZ interacting protein 1 ) E2f8 ( E2F transcription factor 8 ) Eag2 ( potassium voltage-gated channel, subfamily H (eag-related), member 5duplicate ) Ebf1 ( early B-cell factor 1 ) Ebf2 ( early B cell factor 2 ) Ebf3 ( early B cell factor 3 ) Ecel1 ( endothelin converting enzyme-like 1 ) Echdc2 ( enoyl Coenzyme A hydratase domain containing 2 ) Ect2 ( ect2 oncogene ) Ednrb ( endothelin receptor type B ) Eed ( embryonic ectoderm development ) Eef1a1 ( eukaryotic translation elongation factor 1 alpha 1 ) Eef1g ( eukaryotic translation elongation factor 1 gamma ) Efna1 ( ephrin A1 ) Efna2 ( ephrin A2 ) Efna3 ( ephrin A3 ) Efna5 ( ephrin A5 ) Efnb1 ( ephrin B1 ) Efnb2 ( ephrin B2 ) Efnb3 ( ephrin B3 ) Efr3a ( EFR3 homolog A (S. cerevisiae) ) Efs ( embryonal Fyn-associated substrate ) EG545864 ( EG545864 predicted gene ) Egr1 ( early growth response 1 ) Ehmt1 ( euchromatic histone methyltransferase 1 ) Eif1 ( eukaryotic translation initiation factor 1 ) Eif1ax ( eukaryotic translation initiation factor 1A, X-linked ) Eif3h ( eukaryotic translation initiation factor 3, subunit H ) Eif4e3 ( eukaryotic translation initiation factor 4E member 3 ) Eif4g1 ( eukaryotic translation initiation factor 4, gamma 1 ) Eif4g2 ( eukaryotic translation initiation factor 4, gamma 2 ) Elavl2 ( ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) ) Elavl3 ( ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) ) Elavl4 ( ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) ) Elfn1 ( leucine rich repeat and fibronectin type III, extracellular 1 ) Elk1 ( ELK1, member of ETS oncogene family ) Elk3 ( ELK3, member of ETS oncogene family ) Ell3 ( elongation factor RNA polymerase II-like 3 ) Elmo1 ( engulfment and cell motility 1, ced-12 homolog (C. elegans) ) Elovl3 ( elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 ) Elovl6 ( ELOVL family member 6, elongation of long chain fatty acids (yeast) ) Eltd1 ( EGF, latrophilin seven transmembrane domain containing 1 ) Emb ( embigin ) Emcn ( endomucin ) Emp1 ( epithelial membrane protein 1 ) Emx1 ( empty spiracles homeobox 1 ) Emx2 ( empty spiracles homeobox 2 ) En1 ( engrailed 1 ) En2 ( engrailed 2 ) Enah ( enabled homolog (Drosophila) ) Enc1 ( ectodermal-neural cortex 1 ) Endod1 ( endonuclease domain containing 1 ) Eno1 ( enolase 1, alpha non-neuron ) Eno2 ( enolase 2, gamma neuronal ) Enpp2 ( ectonucleotide pyrophosphatase/phosphodiesterase 2 ) Entpd3 ( ectonucleoside triphosphate diphosphohydrolase 3 ) Entpd4 ( ectonucleoside triphosphate diphosphohydrolase 4 ) Eomes ( eomesodermin homolog (Xenopus laevis) ) Epb41 ( erythrocyte protein band 4.1 ) Epb41l1 ( erythrocyte protein band 4.1-like 1 ) Epb41l2 ( erythrocyte protein band 4.1-like 2 ) Epb41l3 ( erythrocyte protein band 4.1-like 3 ) Epb49 ( erythrocyte protein band 4.9 ) Epc1 ( enhancer of polycomb homolog 1 (Drosophila) ) Epha1 ( Eph receptor A1 ) Epha2 ( Eph receptor A2 ) Epha3 ( Eph receptor A3 ) Epha4 ( Eph receptor A4 ) Epha5 ( Eph receptor A5 ) Epha6 ( Eph receptor A6 ) Epha7 ( Eph receptor A7 ) Epha8 ( Eph receptor A8 ) Ephb1 ( Eph receptor B1 ) Ephb2 ( Eph receptor B2 ) Ephb6 ( Eph receptor B6 ) Eps8 ( epidermal growth factor receptor pathway substrate 8 ) Eps8l2 ( EPS8-like 2 ) Epyc ( epiphycan ) Erbb4 ( v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) ) Erp29 ( endoplasmic reticulum protein 29 ) Errfi1 ( ERBB receptor feedback inhibitor 1 ) Esr1 ( estrogen receptor 1 (alpha) ) Esr2 ( estrogen receptor 2 (beta) ) Esrra ( estrogen related receptor, alpha ) Esyt3 ( extended synaptotagmin-like protein 3 ) Etl4 ( enhancer trap locus 4 ) Etv1 ( ets variant gene 1 ) Etv5 ( ets variant gene 5 ) Etv6 ( ets variant gene 6 (TEL oncogene) ) Evx1 ( even skipped homeotic gene 1 homolog ) Evx2 ( even skipped homeotic gene 2 homolog ) Eya1 ( eyes absent 1 homolog (Drosophila) ) F2r ( coagulation factor II (thrombin) receptor ) Faah ( fatty acid amide hydrolase ) Fabp3 ( fatty acid binding protein 3, muscle and heart ) Fabp7 ( fatty acid binding protein 7, brain ) Fam131a ( family with sequence similarity 131, member A ) Fam171b ( family with sequence similarity 171, member B ) Fam20a ( family with sequence similarity 20, member A ) Fam21 ( family with sequence similarity 21 ) Fam43a ( family with sequence similarity 43, member A ) Fam49a ( family with sequence similarity 49, member A ) Fam65b ( family with sequence similarity 65, member B ) Fam81a ( family with sequence similarity 81, member A ) Fam84a ( family with sequence similarity 84, member A ) Farp1 ( FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived) ) Fat3 ( FAT tumor suppressor homolog 3 (Drosophila) ) Fbxl5 ( F-box and leucine-rich repeat protein 5 ) Fbxo32 ( F-box protein 32 ) Fcer1g ( Fc receptor, IgE, high affinity I, gamma polypeptide ) Fem1a ( feminization 1 homolog a (C. elegans) ) Fev ( FEV (ETS oncogene family) ) Fezf1 ( Fez family zinc finger 1 ) Fezf2 ( Fez family zinc finger 2 ) Fgd5 ( FYVE, RhoGEF and PH domain containing 5 ) Fgf1 ( fibroblast growth factor 1 ) Fgf10 ( fibroblast growth factor 10 ) Fgf13 ( fibroblast growth factor 13 ) Fgf14 ( fibroblast growth factor 14 ) Fgf15 ( fibroblast growth factor 15 ) Fgf17 ( fibroblast growth factor 17 ) Fgf3 ( fibroblast growth factor 3 ) Fgf8 ( fibroblast growth factor 8 ) Fgfr1 ( fibroblast growth factor receptor 1 ) Fgfr2 ( fibroblast growth factor receptor 2 ) Fgfr3 ( fibroblast growth factor receptor 3 ) Fgfr4 ( fibroblast growth factor receptor 4 ) Fhdc1 ( FH2 domain containing 1 ) Fhit ( fragile histidine triad gene ) Fhod3 ( formin homology 2 domain containing 3 ) Fign ( fidgetin ) Fkbp1b ( FK506 binding protein 1b ) Fkbp2 ( FK506 binding protein 2 ) Fkbp3 ( FK506 binding protein 3 ) Flrt1 ( fibronectin leucine rich transmembrane protein 1 ) Flrt2 ( fibronectin leucine rich transmembrane protein 2 ) Flrt3 ( fibronectin leucine rich transmembrane protein 3 ) Fmr1 ( fragile X mental retardation syndrome 1 ) Fn1 ( fibronectin 1 ) Fos ( FBJ osteosarcoma oncogene ) Fosb ( FBJ osteosarcoma oncogene B ) Foxa1 ( forkhead box A1 ) Foxa2 ( Forkhead box A2. ) Foxg1 ( forkhead box G1 ) Foxi1 ( forkhead box I1 ) Foxi2 ( forkhead box I2 ) Foxl1 ( forkhead box L1 ) Foxm1 ( forkhead box M1 ) Foxo1 ( forkhead box O1 ) Foxo3a ( forkhead box O3a ) Foxp1 ( forkhead box P1 ) Foxp2 ( forkhead box P2 ) FoxP3 ( forkhead box p3 ) Foxp4 ( forkhead box P4 ) Frat1 ( frequently rearranged in advanced T cell lymphomas ) Frem2 ( Fras1 related extracellular matrix protein 2 ) Fryl ( furry homolog-like (Drosophila) ) Frzb ( frizzled-related protein ) Fst ( follistatin ) Fstl1 ( follistatin-like 1 ) Fstl5 ( follistatin-like 5 ) Fubp1 ( far upstream element (FUSE) binding protein 1 ) Fxyd6 ( FXYD domain-containing ion transport regulator 6 ) Fxyd7 ( FXYD domain-containing ion transport regulator 7 ) Fyn ( Fyn proto-oncogene ) Fzd10 ( frizzled homolog 10 (Drosophila) ) Fzd2 ( frizzled homolog 2 (Drosophila) ) Fzd3 ( frizzled homolog 3 (Drosophila) ) Fzd5 ( frizzled homolog 5 (Drosophila) ) Fzd8 ( frizzled homolog 8 (Drosophila) ) Fzd9 ( frizzled homolog 9 (Drosophila) ) Gaa ( glucosidase, alpha, acid ) Gabarapl1 ( gamma-aminobutyric acid (GABA) A receptor-associated protein-like 1 ) Gabbr1 ( gamma-aminobutyric acid (GABA) B receptor, 1 ) Gabbr2 ( gamma-aminobutyric acid (GABA) B receptor 2 ) Gabra1 ( gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 1 ) Gabra2 ( gamma-aminobutyric acid (GABA) A receptor, subunit alpha 2 ) Gabra4 ( gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 4 ) Gabra5 ( gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 5 ) Gabra6 ( gamma-aminobutyric acid (GABA) A receptor, subunit alpha 6 ) Gabrb2 ( gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 ) Gabrb3 ( gamma-aminobutyric acid (GABA-A) receptor, subunit beta 3 ) Gabrd ( gamma-aminobutyric acid (GABA-A) receptor, subunit delta ) Gabre ( gamma-aminobutyric acid (GABA) A receptor, subunit epsilon ) Gabrg1 ( gamma-aminobutyric acid (GABA) A receptor, subunit gamma 1 ) Gabrg2 ( gamma-aminobutyric acid (GABA) A receptor, subunit gamma 2 ) Gabrq ( gamma-aminobutyric acid (GABA-A) receptor, subunit theta ) Gabrr2 ( gamma-aminobutyric acid (GABA-C) receptor, subunit rho 2 ) Gabrr3 ( gamma-aminobutyric acid (GABA) receptor, rho 3 ) Gad1 ( glutamic acid decarboxylase 1 ) Gad2 ( glutamic acid decarboxylase 2 ) Gal ( galanin ) Galnt1 ( UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 ) Galnt10 ( UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 ) Galnt5 ( UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 ) Galnt9 ( UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 ) Galntl1 ( UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1 ) Galr1 ( galanin receptor 1 ) Galr2 ( galanin receptor 2 ) Galr3 ( galanin receptor 3 ) Gap43 ( growth associated protein 43 ) Gapdh ( glyceraldehyde-3-phosphate dehydrogenase ) Gas1 ( growth arrest specific 1 ) Gas7 ( growth arrest specific 7 ) Gata6 ( GATA binding protein 6 ) Gbas ( glioblastoma amplified sequence ) Gbe1 ( glucan (1,4-alpha-), branching enzyme 1 ) Gbx2 ( gastrulation brain homeobox 2 ) Gch1 ( GTP cyclohydrolase 1 ) Gchfr ( GTP cyclohydrolase I feedback regulator ) Gck ( glucokinase ) Gcm2 ( glial cells missing homolog 2 (Drosophila) ) Gda ( guanine deaminase ) Gdf10 ( growth differentiation factor 10 ) Gdf7 ( growth differentiation factor 7 ) Gdnf ( glial cell line derived neurotrophic factor ) Gfap ( glial fibrillary acidic protein ) Gfra1 ( glial cell line derived neurotrophic factor family receptor alpha 1 ) Gfra2 ( glial cell line derived neurotrophic factor family receptor alpha 2 ) Ghsr ( growth hormone secretagogue receptor ) Gipc2 ( GIPC PDZ domain containing family, member 2 ) Gja1 ( gap junction protein, alpha 1 ) Gjb1 ( gap junction membrane channel protein beta 1 ) Gjc1 ( gap junction protein, gamma 1 ) Gjd2 ( gap junction protein, delta 2 ) Glce ( glucuronyl C5-epimerase ) Gldc ( glycine decarboxylase ) Gli1 ( GLI-Kruppel family member GLI1 ) Gli2 ( GLI-Kruppel family member GLI2 ) Gli3 ( GLI-Kruppel family member GLI3 ) Glp1r ( glucagon-like peptide 1 receptor ) Glra1 ( glycine receptor, alpha 1 subunit ) Glra2 ( glycine receptor, alpha 2 subunit ) Glra3 ( glycine receptor, alpha 3 subunit ) Glrb ( glycine receptor, beta subunit ) Gls ( glutaminase ) Glud1 ( glutamate dehydrogenase 1 ) Gnal ( guanine nucleotide binding protein, alpha stimulating, olfactory type ) Gnao1 ( guanine nucleotide binding protein, alpha o ) Gnas ( GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus ) Gnb4 ( guanine nucleotide binding protein (G protein), beta 4 ) Gng10 ( guanine nucleotide binding protein (G protein), gamma 10 ) Gng12 ( guanine nucleotide binding protein (G protein), gamma 12 ) Gng13 ( guanine nucleotide binding protein (G protein), gamma 13 ) Gng2 ( guanine nucleotide binding protein (G protein), gamma 2 subunit ) Gng3 ( guanine nucleotide binding protein (G protein), gamma 3 ) Gng4 ( guanine nucleotide binding protein (G protein), gamma 4 ) Gng5 ( guanine nucleotide binding protein (G protein), gamma 5 ) Gng7 ( guanine nucleotide binding protein (G protein), gamma 7 ) Gopc ( golgi associated PDZ and coiled-coil motif containing ) Gp1bb ( glycoprotein Ib, beta polypeptide ) Gpc1 ( Glypican 1 ) Gpc3 ( glypican 3 ) Gpc4 ( glypican 4 ) Gphn ( gephyrin ) Gpm6a ( glycoprotein m6a ) Gpr101 ( G protein-coupled receptor 101 ) Gpr12 ( G-protein coupled receptor 12 ) Gpr123 ( G protein-coupled receptor 123 ) Gpr139 ( G protein-coupled receptor 139 ) Gpr151 ( G protein-coupled receptor 151 ) Gpr155 ( G protein-coupled receptor 155 ) Gpr158 ( G protein-coupled receptor 158 ) Gpr161 ( G protein-coupled receptor 161 ) Gpr165 ( G protein-coupled receptor 165 ) Gpr171 ( G protein-coupled receptor 171 ) Gpr176 ( G protein-coupled receptor 176 ) Gpr21 ( G protein-coupled receptor 21 ) Gpr26 ( G protein-coupled receptor 26 ) Gpr27 ( G protein-coupled receptor 27 ) Gpr30 ( G protein-coupled receptor 30 ) Gpr37 ( G protein-coupled receptor 37 ) Gpr37l1 ( G protein-coupled receptor 37-like 1 ) Gpr4 ( G protein-coupled receptor 4 ) Gpr50 ( G-protein-coupled receptor 50 ) Gpr56 ( G protein-coupled receptor 56 ) Gpr6 ( G protein-coupled receptor 6 ) Gpr63 ( G protein-coupled receptor 63 ) Gpr68 ( G protein-coupled receptor 68 ) Gpr83 ( G protein-coupled receptor 83 ) Gpr88 ( G-protein coupled receptor 88 ) Gprc5b ( G protein-coupled receptor, family C, group 5, member B ) Gprc5c ( G protein-coupled receptor, family C, group 5, member C ) Gprc5d ( G protein-coupled receptor, family C, group 5, member D ) Gprin3 ( GPRIN family member 3 ) Gpsm1 ( G-protein signalling modulator 1 (AGS3-like, C. elegans) ) GpX3 ( Glutathione peroxidase 3 ) Grb10 ( growth factor receptor bound protein 10 ) Grhl1 ( transcription factor CP2-like 2 ) Gria1 ( glutamate receptor, ionotropic, AMPA1 (alpha 1) ) Gria2 ( glutamate receptor, ionotropic, AMPA2 (alpha 2) ) Grid1 ( glutamate receptor, ionotropic, delta 1 ) Grid2 ( glutamate receptor, ionotropic, delta 2 ) Grid2ip ( glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1 ) Grik1 ( glutamate receptor, ionotropic, kainate 1 ) Grik2 ( glutamate receptor, ionotropic, kainate 2 (beta 2) ) Grik3 ( glutamate receptor, ionotropic, kainate 3 ) Grik4 ( glutamate receptor, ionotropic, kainate 4 ) Grik5 ( glutamate receptor, ionotropic, kainate 5 ) Grin1 ( glutamate receptor, ionotropic, NMDA1 (zeta 1) ) Grin2a ( glutamate receptor, ionotropic, NMDA2A (epsilon 1) ) Grin2c ( glutamate receptor, ionotropic, NMDA2C (epsilon 3) ) Grin2d ( glutamate receptor, ionotropic, NMDA2D (epsilon 4) ) Grin3b ( glutamate receptor, ionotropic, NMDA3B ) Grm1 ( glutamate receptor, metabotropic 1 ) Grm2 ( glutamate receptor, metabotropic 2 ) Grm3 ( glutamate receptor, metabotropic 3 ) Grm4 ( glutamate receptor, metabotropic 4 ) Grm5 ( glutamate receptor, metabotropic 5 ) Grm6 ( glutamate receptor, metabotropic 6 ) Grm8 ( glutamate receptor, metabotropic 8 ) Grn ( granulin ) Grp ( gastrin releasing peptide ) Grpr ( gastrin releasing peptide receptor ) Grtp1 ( GH regulated TBC protein 1 ) Gsc ( goosecoid homeobox ) Gsc2 ( goosecoid homebox 2 ) Gsg1l ( GSG1-like ) Gsn ( gelsolin ) Gsx1 ( GS homeobox 1 ) Gsx2 ( GS homeobox 2 ) Gtf2h4 ( general transcription factor II H, polypeptide 4 ) Gtf2i ( general transcription factor II I ) Gucy1a3 ( guanylate cyclase 1, soluble, alpha 3 ) Gucy2c ( guanylate cyclase 2c ) H2-D1 ( histocompatibility 2, D region locus 1 ) H2-K1 ( histocompatibility 2, K1, K region ) H2-L ( histocompatibility 2, D region ) H2-T10 ( histocompatibility 2, T region locus 10 ) H2-T22 ( histocompatibility 2, T region locus 22 ) H2-T23 ( histocompatibility 2, T region locus 23 ) H2afz ( H2A histone family, member Z ) H3f3a ( H3 histone, family 3A ) Hap1 ( huntingtin-associated protein 1 ) Hax1 ( HS1 binding protein ) Hbegf ( heparin-binding EGF-like growth factor ) Hcfc1 ( host cell factor C1 ) Hcfc2 ( host cell factor C2 ) Hcn1 ( hyperpolarization-activated, cyclic nucleotide-gated K+ 1 ) Hcn2 ( hyperpolarization-activated, cyclic nucleotide-gated K+ 2 ) Hcn3 ( hyperpolarization-activated, cyclic nucleotide-gated K+ 3 ) Hcn4 ( hyperpolarization-activated, cyclic nucleotide-gated K+ 4 ) Hcn4duplicate ( Hcn4 duplicate ) Hcrt ( hypocretin ) Hcrtr1 ( hypocretin (orexin) receptor 1 ) Hcrtr2 ( hypocretin (orexin) receptor 2 ) Hdac11 ( histone deacetylase 11 ) Hdac9 ( histone deacetylase 9 ) Hdc ( histidine decarboxylase ) Herc3 ( hect domain and RLD 3 ) Hes1 ( hairy and enhancer of split 1 (Drosophila) ) Hes5 ( hairy and enhancer of split 5 (Drosophila) ) Hes6 ( hairy and enhancer of split 6 (Drosophila) ) Hey1 ( hairy/enhancer-of-split related with YRPW motif 1 ) Hey2 ( hairy/enhancer-of-split related with YRPW motif 2 ) Heyl ( hairy/enhancer-of-split related with YRPW motif-like ) Hgf ( hepatocyte growth factor ) Hgs ( HGF-regulated tyrosine kinase substrate ) Hhip ( Hedgehog-interacting protein ) Hipk2 ( homeodomain interacting protein kinase 2 ) Hira ( histone cell cycle regulation defective homolog A (S. cerevisiae) ) Hivep2 ( human immunodeficiency virus type I enhancer binding protein 2 ) Hlf ( hepatic leukemia factor ) Hmgcs1 ( 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 ) Hmgn2 ( high mobility group nucleosomal binding domain 2 ) Hmgn3 ( high mobility group nucleosomal binding domain 3 ) Hmx3 ( H6 homeobox 3 ) Hnrnpab ( heterogeneous nuclear ribonucleoprotein A/B ) Hnrph3 ( heterogeneous nuclear ribonucleoprotein H3 ) Hnrpul1 ( heterogeneous nuclear ribonucleoprotein U-like 1 ) Hnt ( neurotrimin ) Homer1 ( homer homolog 1 (Drosophila) ) Homer2 ( homer homolog 2 (Drosophila) ) Homer3 ( homer homolog 3 (Drosophila) ) Hoxa5 ( homeobox A5 ) Hoxa9 ( homeo box A9 ) Hoxc10 ( homeobox C10 ) Hoxd10 ( homeobox D10 ) Hpcal1 ( hippocalcin-like 1 ) Hpcal4 ( hippocalcin-like 4 ) Hprt1 ( hypoxanthine guanine phosphoribosyl transferase 1 ) Hpse ( heparanase ) Hrasls ( HRAS-like suppressor ) Hrh1 ( histamine receptor H 1 ) Hrh2 ( histamine receptor H2 ) Hrh3 ( histamine receptor H 3 ) Hs6st2 ( heparan sulfate 6-O-sulfotransferase 2 ) Hsd11b1 ( hydroxysteroid 11-beta dehydrogenase 1 ) Hspa12a ( heat shock protein 12A ) Hspa12b ( heat shock protein 12B ) Hspb1 ( heat shock protein 1 ) Hspb8 ( heat shock protein 8 ) Htr1a ( 5-hydroxytryptamine (serotonin) receptor 1A ) Htr1b ( 5-hydroxytryptamine (serotonin) receptor 1B ) Htr1d ( 5-hydroxytryptamine (serotonin) receptor 1D ) Htr1f ( 5-hydroxytryptamine (serotonin) receptor 1F ) Htr2a ( 5-hydroxytryptamine (serotonin) receptor 2A ) HTR2Ahuman ( 5-hydroxytryptamine (serotonin) receptor 2A (Human) ) Htr2b ( 5-hydroxytryptamine (serotonin) receptor 2B ) Htr2c ( 5-hydroxytryptamine (serotonin) receptor 2C ) Htr3a ( 5-hydroxytryptamine (serotonin) receptor 3A ) Htr3b ( 5-hydroxytryptamine (serotonin) receptor 3B ) Htr4 ( 5 hydroxytryptamine (serotonin) receptor 4 ) Htr5a ( 5-hydroxytryptamine (serotonin) receptor 5A ) Htr5b ( 5-hydroxytryptamine (serotonin) receptor 5B ) Htr6 ( 5-hydroxytryptamine (serotonin) receptor 6 ) Htr7 ( 5-hydroxytryptamine (serotonin) receptor 7 ) humanNLGN3 ( neuroligin 3 (human) ) HYAL1 ( hyaluronoglucosaminidase 1 ) Icam5 ( intercellular adhesion molecule 5, telencephalin ) Ict1 ( immature colon carcinoma transcript 1 ) Id1 ( inhibitor of DNA binding 1 ) Id2 ( inhibitor of DNA binding 2 ) Id3 ( inhibitor of DNA binding 3 ) Id4 ( inhibitor of DNA binding 4 ) Idh3a ( isocitrate dehydrogenase 3 (NAD+) alpha ) Ier3ip1 ( immediate early response 3 interacting protein 1 ) Ier5 ( immediate early response 5 ) Ifi203 ( interferon activated gene 203 ) Ifi205 ( interferon activated gene 205 ) Ifi44 ( interferon-induced protein 44 ) Ifngr2 ( interferon gamma receptor 2 ) Igf1 ( insulin-like growth factor 1 ) Igf1r ( insulin-like growth factor I receptor ) Igfbp1 ( insulin-like growth factor binding protein 1 ) Igfbp2 ( insulin-like growth factor binding protein 2 ) Igfbp3 ( insulin-like growth factor binding protein 3 ) Igfbp4 ( insulin-like growth factor binding protein 4 ) Igfbp5 ( insulin-like growth factor binding protein 5 ) Igfbp5duplicate ( Insulin-like growth factor binding protein 5 duplicate ) Igfbp6 ( insulin-like growth factor binding protein 6 ) Igfn1 ( immunoglobulin-like and fibronectin type III domain containing 1 ) Igh-6 ( immunoglobulin heavy chain 6 (heavy chain of IgM) ) Igsf9 ( immunoglobulin superfamily, member 9 ) Ikzf4 ( IKAROS family zinc finger 4 ) Il12a ( interleukin 12a ) Il12b ( interleukin 12b ) Il13ra1 ( interleukin 13 receptor, alpha 1 ) Il16 ( interleukin 16 ) Impa1 ( inositol (myo)-1(or 4)-monophosphatase 1 ) Inadl ( InaD-like (Drosophila) ) Incorrect ( Incorrect Lynx1 ) Incorrect2 ( Incorrect Lynx2 ) Inhba ( inhibin beta-A ) Inpp5a ( inositol polyphosphate-5-phosphatase A ) Inpp5j ( inositol polyphosphate 5-phosphatase J ) Insig2 ( insulin induced gene 2 ) Insm2 ( insulinoma-associated 2 ) Iqgap3 ( IQ motif containing GTPase activating protein 3 ) Iqsec3 ( IQ motif and Sec7 domain 3 ) Irs4 ( insulin receptor substrate 4 ) Irx1 ( Iroquois related homeobox 1 (Drosophila) ) Irx2 ( Iroquois related homeobox 2 (Drosophila) ) Irx3 ( Iroquois related homeobox 3 (Drosophila) ) Irx4 ( Iroquois related homeobox 4 (Drosophila) ) Irx5 ( Iroquois related homeobox 5 (Drosophila) ) Isl1 ( ISL1 transcription factor, LIM/homeodomain (islet 1) ) Isl2 ( insulin related protein 2 (islet 2) ) Islr2 ( immunoglobulin superfamily containing leucine-rich repeat 2 ) Itga2b ( integrin alpha 2b ) Itga3 ( integrin alpha 3 ) Itga7 ( integrin alpha 7 ) Itgax ( Integrin alpha X ) Itgb1 ( integrin beta 1 (fibronectin receptor beta) ) Itgb3 ( integrin beta 3 ) Itgb5 ( integrin beta 5 ) Itgb8 ( integrin beta 8 ) Itm2b ( integral membrane protein 2B ) Itpka ( inositol 1,4,5-trisphosphate 3-kinase A ) Itpr1 ( inositol 1,4,5-triphosphate receptor 1 ) Jag1 ( jagged 1 ) Jag2 ( jagged 2 ) Jak2 ( Janus kinase 2 ) Jam3 ( junction adhesion molecule 3 ) Jph3 ( junctophilin 3 ) Jph4 ( junctophilin 4 ) Jup ( junction plakoglobin ) Kalrn ( kalirin, RhoGEF kinase ) Kank4 ( KN motif and ankyrin repeat domains 4 ) Kcna1 ( potassium voltage-gated channel, shaker-related subfamily, member 1 ) Kcna4 ( potassium voltage-gated channel, shaker-related subfamily, member 4 ) Kcnab1 ( potassium voltage-gated channel, shaker-related subfamily, beta member 1 ) Kcnab2 ( potassium voltage-gated channel, shaker-related subfamily, beta member 2 ) Kcnab3 ( potassium voltage-gated channel, shaker-related subfamily, beta member 3 ) Kcnb4-A ( potassium channel beta 4 subunit [Xenopus laevis] ) Kcnc1 ( potassium voltage gated channel, Shaw-related subfamily, member 1 ) Kcnc2 ( potassium voltage gated channel, Shaw-related subfamily, member 2 ) Kcnc3 ( potassium voltage gated channel, Shaw-related subfamily, member 3 ) Kcnc4 ( potassium voltage gated channel, Shaw-related subfamily, member 4 ) Kcnd2 ( potassium voltage-gated channel, Shal-related family, member 2 ) Kcnd3 ( potassium voltage-gated channel, Shal-related family, member 3 ) Kcng3 ( potassium voltage-gated channel, subfamily G, member 3 ) Kcng4 ( potassium voltage-gated channel, subfamily G, member 4 ) Kcnh1 ( potassium voltage-gated channel, subfamily H (eag-related), member 1 ) Kcnh2 ( potassium voltage-gated channel, subfamily H (eag-related), member 2 ) Kcnh4 ( potassium voltage-gated channel, subfamily H (eag-related), member 4 ) Kcnh5 ( potassium voltage-gated channel, subfamily H (eag-related), member 5 ) Kcnh7 ( potassium voltage-gated channel, subfamily H (eag-related), member 7 ) Kcnip1 ( Kv channel-interacting protein 1 ) Kcnip2 ( Kv channel-interacting protein 2 ) Kcnip3 ( Kv channel interacting protein 3, calsenilin ) Kcnip4 ( Kv channel interacting protein 4 ) Kcnj10 ( potassium inwardly-rectifying channel, subfamily J, member 10 ) Kcnj14 ( potassium inwardly-rectifying channel, subfamily J, member 14 ) Kcnj2 ( potassium inwardly-rectifying channel, subfamily J, member 2 ) Kcnj3 ( potassium inwardly-rectifying channel, subfamily J, member 3 ) Kcnj5 ( potassium inwardly-rectifying channel, subfamily J, member 5 ) Kcnj6 ( potassium inwardly-rectifying channel, subfamily J, member 6 ) Kcnk1 ( potassium channel, subfamily K, member 1 ) Kcnk13 ( potassium channel, subfamily K, member 13 ) Kcnk2 ( potassium channel, subfamily K, member 2 ) Kcnma1 ( potassium large conductance calcium-activated channel, subfamily M, alpha member 1 ) Kcnmb4 ( potassium large conductance calcium-activated channel, subfamily M, beta member 4 ) Kcnq2 ( potassium voltage-gated channel, subfamily Q, member 2 ) Kcnq3 ( potassium voltage-gated channel, subfamily Q, member 3 ) Kcnt1 ( potassium channel, subfamily T, member 1 ) Kcnv1 ( potassium channel, subfamily V, member 1 ) Kctd1 ( potassium channel tetramerisation domain containing 1 ) Kctd11 ( potassium channel tetramerisation domain containing 11 ) Kctd12 ( potassium channel tetramerisation domain containing 12 ) Kctd13 ( potassium channel tetramerisation domain containing 13 ) Kctd17 ( potassium channel tetramerisation domain containing 17 ) Kctd4 ( potassium channel tetramerisation domain containing 4 ) Kctd9 ( potassium channel tetramerisation domain containing 9 ) Kdm5b ( lysine (K)-specific demethylase 5B ) Kel ( Kell blood group ) Kera ( keratocan ) Khdrbs1 ( KH domain containing, RNA binding, signal transduction associated 1 ) KIAA0319 ( KIAA0319 ) KIAA1292 ( KIAA1292 ) Kif11 ( kinesin family member 11 ) Kif17 ( kinesin family member 17 ) Kif1b ( kinesin family member 1B ) Kif26a ( kinesin family member 26A ) Kif4 ( kinesin family member 4 ) Kif5a ( kinesin family member 5A ) Kirrel3 ( kin of IRRE like 3 (Drosophila) ) Kiss1r ( KISS1 receptor ) Kit ( kit oncogene ) Kitl ( kit ligand ) Klc3 ( kinesin light chain 3 ) Klf10 ( Kruppel-like factor 10 ) Klf13 ( Kruppel-like factor 13 ) Klf16 ( Kruppel-like factor 16 ) KLHL1 ( kelch-like 1 (Drosophila) ) Klhl23 ( kelch-like 23 ) Klk1b4 ( kallikrein 1-related pepidase b4 ) Klk8 ( kallikrein related-peptidase 8 ) Klra1 ( killer cell lectin-like receptor, subfamily A, member 1 ) Klra3 ( killer cell lectin-like receptor, subfamily A, member 3 ) Kremen1 ( kringle containing transmembrane protein 1 ) Krt12 ( keratin 12 ) Krt18 ( keratin 18 ) Krt19 ( keratin 19 ) Ksr1 ( kinase suppressor of ras 1 ) L1cam ( L1 cell adhesion molecule ) Lamb1 ( laminin B1 ) Lamb3 ( laminin, beta 3 ) Lamc3 ( laminin gamma 3 ) Lamp5 ( lysosomal-associated membrane protein family, member 5 ) Laptm4b ( lysosomal-associated protein transmembrane 4B ) Lats2 ( large tumor suppressor 2 ) Layn ( layilin ) Lbh ( limb-bud and heart ) Lbx2 ( ladybird homeobox homolog 2 (Drosophila) ) Lcp2 ( lymphocyte cytosolic protein 2 ) Ldb1 ( LIM domain binding 1 ) Ldb2 ( LIM domain binding 2 ) Lect1 ( leukocyte cell derived chemotaxin 1 ) Lef1 ( lymphoid enhancer binding factor 1 ) Leng8 ( leukocyte receptor cluster (LRC) member 8 ) Lepr ( leptin receptor ) Lfng ( LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase ) Lgals1 ( lectin, galactose binding, soluble 1 ) Lgals3 ( lectin, galactose binding, soluble 3 ) Lgals9 ( lectin, galactose binding, soluble 9 ) Lgi1 ( leucine-rich repeat LGI family, member 1 ) Lgi2 ( leucine-rich repeat LGI family, member 2 ) Lgi3 ( leucine-rich repeat LGI family, member 3 ) Lgi4 ( leucine-rich repeat LGI family, member ) Lhfp ( lipoma HMGIC fusion partner ) Lhx1 ( LIM homeobox protein 1 ) Lhx2 ( LIM homeobox protein 2 ) Lhx3 ( LIM homeobox protein 3 ) Lhx4 ( LIM homeobox protein 4 ) Lhx5 ( LIM homeobox protein 5 ) Lhx6 ( LIM homeobox protein 6 ) Lhx8 ( LIM homeobox protein 8 ) Lhx9 ( LIM homeobox protein 9 ) Lifr ( Leukemia inhibitory factor receptor ) Lilrb3 ( leukocyte immunoglobulin-like receptor, subfamily B ) Lima1 ( LIM domain and actin binding 1 ) Limch1 ( LIM and calponin homology domains 1 ) Limd2 ( LIM domain containing 2 ) Limk1 ( LIM-domain containing, protein kinase ) Limk2 ( LIM motif-containing protein kinase 2 ) Lix1 ( limb expression 1 homolog (chicken) ) Lmna ( lamin A ) Lmo1 ( LIM domain only 1 ) Lmo2 ( LIM domain only 2 ) Lmo3 ( LIM domain only 3 ) Lmo4 ( LIM domain only 4 ) Lmx1a ( LIM homeobox transcription factor 1 alpha ) Lmx1b ( LIM homeobox transcription factor 1 beta ) LOC233220 ( similar to MrgA6 G protein-coupled receptor ) LOC236844 ( similar to RIKEN cDNA 3110001N18 ) LOC240233 ( similar to KIAA1317 protein ) LOC329150 ( similar to axonemal dynein heavy chain 7 ) LOC383757 ( similar to Transcriptional repressor scratch 2 (Scratch homolog 2 zinc finger protein) ) LOC433228 ( hypothetical gene supported by AK082257 ) LOC547214 ( similar to G protein coupled receptor ) LOC553091 ( hypothetical LOC553091 ) LOC553901 ( hypothetical LOC553901 ) LOC675706 ( similar to melanoma antigen ) Lpar1 ( lysophosphatidic acid receptor 1 ) Lphn1 ( latrophilin 1 ) Lpl ( lipoprotein lipase ) Lrba ( LPS-responsive beige-like anchor ) Lrfn2 ( leucine rich repeat and fibronectin type III domain containing 2 ) Lrfn5 ( leucine rich repeat and fibronectin type III domain containing 5 ) Lrig1 ( leucine-rich repeats and immunoglobulin-like domains 1 ) Lrig2 ( leucine-rich repeats and immunoglobulin-like domains 2 ) Lrp10 ( low-density lipoprotein receptor-related protein 10 ) Lrp12 ( low density lipoprotein-related protein 12 ) Lrp2 ( low density lipoprotein receptor-related protein 2 ) Lrp3 ( low density lipoprotein receptor-related protein 3 ) Lrp8 ( low density lipoprotein receptor-related protein 8, apolipoprotein e receptor ) Lrpap1 ( low density lipoprotein receptor-related protein associated protein 1 ) Lrrc16a ( leucine rich repeat containing 16A ) Lrrc4 ( leucine rich repeat containing 4 ) Lrrc47 ( RIKEN cDNA 2900010D03 gene ) Lrrc55 ( leucine rich repeat containing 55 ) Lrrc8c ( leucine rich repeat containing 8 family, member C ) Lrrk2 ( leucine-rich repeat kinase 2 ) Lrrn1 ( leucine rich repeat protein 1, neuronal ) Lrrn2 ( leucine rich repeat protein 2, neuronal ) Lrrn3 ( leucine rich repeat protein 3, neuronal ) Lrrtm1 ( leucine rich repeat transmembrane neuronal 1 ) Lrrtm2 ( leucine rich repeat transmembrane neuronal 2 ) Lrrtm3 ( leucine rich repeat transmembrane neuronal 3 ) Lsamp ( limbic system-associated membrane protein ) Lss ( lanosterol synthase ) Lxn ( latexin ) Ly6e ( lymphocyte antigen 6 complex, locus E ) Ly6h ( lymphocyte antigen 6 complex, locus H ) Ly6k ( lymphocyte antigen 6 complex, locus K ) Lynx1 ( Ly6/neurotoxin 1 ) Lypd1 ( Ly6/Plaur domain containing 1 ) Lypd2 ( Ly6/Plaur domain containing 2 ) Lypd6 ( LY6/PLAUR domain containing 6 ) Lzts1 ( leucine zipper, putative tumor suppressor 1 ) Mafa ( v-maf musculoaponeurotic fibrosarcoma oncogene family, protein A (avian) ) Mafb ( v-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian) ) Mag ( myelin-associated glycoprotein ) MAGEA8 ( melanoma antigen family A, 8 ) Maged1 ( melanoma antigen, family D, 1 ) Magel2 ( melanoma antigen, family L, 2 ) Man1a ( mannosidase 1, alpha ) Man1a2 ( mannosidase, alpha, class 1A, member 2 ) Maoa ( monoamine oxidase A ) Maob ( monoamine oxidase B ) Map1b ( microtubule-associated protein 1B ) Map1lc3a ( microtubule-associated protein 1 light chain 3 alpha ) Map2k6 ( mitogen-activated protein kinase kinase 6 ) Map4k5 ( mitogen-activated protein kinase kinase kinase kinase 5 ) Mapk1 ( mitogen-activated protein kinase 1 ) Mapk3 ( mitogen activated protein kinase 3 ) Mapk4 ( mitogen-activated protein kinase 4 ) Mapk8 ( mitogen-activated protein kinase 8 ) Mapk9 ( mitogen activated protein kinase 9 ) Mapt ( microtubule-associated protein tau ) March1 ( membrane-associated ring finger (C3HC4) 1 ) March4 ( membrane-associated ring finger (C3HC4) 4 ) Marcksl1 ( MARCKS-like 1 ) Mas1 ( MAS1 oncogene ) Matk ( megakaryocyte-associated tyrosine kinase ) Mb21d2 ( Mab-21 domain containing 2 ) Mbc2 ( membrane bound C2 domain containing protein ) Mbd2 ( methyl-CpG binding domain protein 2 ) Mbd3 ( methyl-CpG binding domain protein 3 ) Mbd4 ( methyl-CpG binding domain protein 4 ) Mbd5 ( methyl-CpG binding domain protein 5 ) Mbp ( myelin basic protein ) Mc3r ( melanocortin 3 receptor ) Mc4r ( melanocortin 4 receptor ) Mcm2 ( minichromosome maintenance deficient 2 mitotin (S. cerevisiae) ) Mcm5 ( minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) ) Mcm7 ( minichromosome maintenance deficient 7 (S. cerevisiae) ) Mdga1 ( MAM domain containing glycosylphosphatidylinositol anchor 1 ) Mdh1 ( malate dehydrogenase 1, NAD (soluble) ) Mdk ( midkine ) Me2 ( malic enzyme 2, NAD(+)-dependent, mitochondrial ) Mecom ( MDS1 and EVI1 complex locus ) Mecp2 ( methyl CpG binding protein 2 ) Med12 ( mediator of RNA polymerase II transcription, subunit 12 homolog (yeast) ) Med4 ( mediator of RNA polymerase II transcription, subunit 4 homolog (yeast) ) Mef2c ( myocyte enhancer factor 2C ) Meis1 ( Meis homeobox 1 ) Meis2 ( Meis homeobox 2 ) Melk ( maternal embryonic leucine zipper kinase ) Meox2 ( mesenchyme homeobox 2 ) Met ( met proto-oncogene ) Mfap2 ( microfibrillar-associated protein 2 ) Mfap4 ( microfibrillar-associated protein 4 ) Mfn1 ( mitofusin 1 ) Mfn2 ( mitofusin 2 ) Mfng ( manic fringe homolog (Drosophila) ) Mgat5 ( mannoside acetylglucosaminyltransferase 5 ) Mgll ( monoglyceride lipase ) Mglur2 ( Rat Metabotropic Glutamate Recep ) Mgst3 ( microsomal glutathione S-transferase 3 ) Mid1 ( midline 1 ) Mif ( macrophage migration inhibitory factor ) Mir24-1 ( Mir24-1 microRNA 24-1 ) Mirn34a ( microRNA 34a ) Mjd ( Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3) homolog (human) ) Mki67 ( antigen identified by monoclonal antibody Ki 67 ) Mllt11 ( myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 ) Mmp15 ( matrix metalloproteinase 15 ) Mmp17 ( matrix metallopeptidase 17 ) Mmp2 ( matrix metallopeptidase 2 ) Mmp9 ( matrix metallopeptidase 9 ) Mnx1 ( motor neuron and pancreas homeobox 1 ) Mobp ( myelin-associated oligodendrocytic basic protein ) Moxd1 ( monooxygenase, DBH-like 1 ) Mpc1 ( mitochondrial pyruvate carrier 1 ) Mpc2 ( mitochondrial pyruvate carrier 2 ) Mpdz ( multiple PDZ domain protein ) Mpp3 ( membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) ) Mpp3 ( membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) ) Mpped1 ( metallophosphoesterase domain containing 1 ) Mrps21 ( mitochondrial ribosomal protein S21 ) Msi2 ( Musashi homolog 2 (Drosophila) ) Msrb2 ( methionine sulfoxide reductase B2 ) Mst1r ( macrophage stimulating 1 receptor (c-met-related tyrosine kinase) ) Msx1 ( homeobox, msh-like 1 ) Mt1 ( metallothionein 1 ) Mtap ( methylthioadenosine phosphorylase ) Mtap2 ( microtubule-associated protein 2 ) Mtap4 ( microtubule-associated protein 4 ) Mtif2 ( mitochondrial translational initiation factor 2 ) Mtnr1a ( melatonin receptor 1A ) Mtss1 ( metastasis suppressor 1 ) Mup2 ( major urinary protein 2 ) Mxi1 ( Max interacting protein 1 ) Mxi1SR ( Max interacting protein 1-SR ) Myc ( myelocytomatosis oncogene ) Mycbp ( c-myc binding protein ) Mycl1 ( lung carcinoma myc related oncogene 1 ) Mycn ( v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) ) Myl6 ( myosin, light polypeptide 6, alkali, smooth muscle and non-muscle ) Myo1b ( myosin IB ) Myt1l ( myelin transcription factor 1-like ) N28178 ( expressed sequence N28178 ) Naca ( nascent polypeptide-associated complex alpha polypeptide ) Nae1 ( NEDD8 activating enzyme E1 subunit 1 ) Napb ( N-ethylmaleimide sensitive fusion protein attachment protein beta ) Nars ( asparaginyl-tRNA synthetase ) Nbl1 ( neuroblastoma, suppression of tumorigenicity 1 ) Ncald ( neurocalcin delta ) Nck2 ( non-catalytic region of tyrosine kinase adaptor protein 2 ) Nckap1 ( NCK-associated protein 1 ) Ncoa1 ( nuclear receptor coactivator 1 ) Ncoa7 ( nuclear receptor coactivator 7 ) Ncor1 ( nuclear receptor co-repressor 1 ) Ndc80 ( NDC80 homolog, kinetochore complex component (S. cerevisiae) ) Ndel1 ( nuclear distribution gene E-like homolog 1 (A. nidulans) ) Ndn ( necdin ) Ndnf ( neuron-derived neurotrophic factor ) Ndrg1 ( N-myc downstream regulated gene 1 ) Ndrg3 ( N-myc downstream regulated gene 3 ) Ndrg4 ( N-myc downstream regulated gene 4 ) Ndst3 ( N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 ) Ndst4 ( N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4 ) Ndufal3 ( genes associated with retinoid-IFN-induced mortality 19 ) Ndufv1 ( NADH dehydrogenase (ubiquinone) flavoprotein 1 ) Ndufv2 ( NADH dehydrogenase (ubiquinone) flavoprotein 2 ) Necab1 ( N-terminal EF-hand calcium binding protein 1 ) Nedd4l ( neural precursor cell expressed, developmentally down-regulated gene 4-like ) Nefh ( neurofilament, heavy polypeptide ) Nefl ( neurofilament, light polypeptide ) Nefm ( neurofilament, medium polypeptide ) Negr1 ( neuronal growth regulator 1 ) Nek7 ( NIMA (never in mitosis gene a)-related expressed kinase 7 ) Nell2 ( NEL-like 2 (chicken) ) Neo1 ( neogenin ) Nes ( nestin ) Neto1 ( neuropilin (NRP) and tolloid (TLL)-like 1 ) Neto2 ( neuropilin (NRP) and tolloid (TLL)-like 2 ) Neurod1 ( neurogenic differentiation 1 ) Neurod2 ( neurogenic differentiation 2 ) Neurod4 ( neurogenic differentiation 4 ) Neurod6 ( neurogenic differentiation 6 ) Neurog1 ( neurogenin 1 ) Neurog2 ( neurogenin 2 ) Neurog3 ( neurogenin 3 ) Nf1 ( neurofibromatosis 1 ) Nf2 ( neurofibromatosis 2 ) Nfia ( nuclear factor I/A ) Nfib ( nuclear factor I/B ) Nfil3 ( nuclear factor, interleukin 3, regulated ) Nfix ( nuclear factor I/X ) Ngef ( neuronal guanine nucleotide exchange factor ) Ngf ( nerve growth factor ) Ngfr ( nerve growth factor receptor (TNFR superfamily, member 16) ) Nhlh1 ( nescient helix loop helix 1 ) Nhp2 ( NHP2 ribonucleoprotein ) Nhsl1 ( NHS-like 1 ) Nisch ( nischarin ) NKAIN2 ( Na+/K+ transporting ATPase interacting 2 ) Nkain3 ( Na+/K+ transporting ATPase interacting 3 ) Nkain4 ( Na+/K+ transporting ATPase interacting 4 ) Nkd1 ( naked cuticle 1 homolog (Drosophila) ) Nkx2-1 ( NK2 homeobox 1 ) Nkx2-2 ( NK2 transcription factor related, locus 2 (Drosophila) ) Nlgn1 ( neuroligin 1 ) Nlgn2 ( neuroligin 2 ) Nlgn3 ( neuroligin 3 ) Nlgn4 ( neuroligin 4 ) Nmb ( neuromedin B ) Nmbr ( neuromedin B receptor ) Nms ( neuromedin S ) Nmu ( neuromedin U ) Nnat ( neuronatin ) Nog ( noggin ) Nomo1 ( nodal modulator 1 ) Nope ( neighbor of Punc E11 ) Nos1 ( nitric oxide synthase 1, neuronal ) NOshortname1 ( chromosome 6 clone RP24-69C19 ) NOshortname2 ( transcribed sequence with weak similarity to protein ref:NP_061720.1 (H.sapiens) axonemal dynein heavy chain 7 [Homo sapiens] ) Notch1 ( notch 1 ) Notch2 ( notch 2 ) Notch3 ( notch 3 ) Nov ( nephroblastoma overexpressed gene ) Nova1 ( neuro-oncological ventral antigen 1 ) Npas1 ( neuronal PAS domain protein 1 ) Npas2 ( neuronal PAS domain protein 2 ) Npas3 ( neuronal PAS domain protein 3 ) Npb ( neuropeptide B ) Npbwr1 ( neuropeptides B/W receptor 1 ) Npc1 ( Niemann Pick type C1 ) Npc1l1 ( NPC1-like 1 ) Npc2 ( Niemann Pick type C2 ) Npnt ( nephronectin ) Npr1 ( natriuretic peptide receptor 1 ) Npr3 ( natriuretic peptide receptor 3 ) Npsr1 ( neuropeptide S receptor 1 ) Nptx1 ( neuronal pentraxin 1 ) Nptx2 ( neuronal pentraxin 2 ) Npvf ( neuropeptide VF precursor ) Npy ( neuropeptide Y ) Npy1r ( neuropeptide Y receptor Y1 ) Npy2r ( neuropeptide Y receptor Y2 ) Npy5r ( neuropeptide Y receptor Y5 ) Nr0b1 ( nuclear receptor subfamily 0, group B, member 1 ) Nr1d1 ( nuclear receptor subfamily 1, group D, member 1 ) Nr2c2 ( nuclear receptor subfamily 2, group C, member 2 ) Nr2e1 ( nuclear receptor subfamily 2, group E, member 1 ) Nr2f1 ( nuclear receptor subfamily 2, group F, member 1 ) Nr2f2 ( nuclear receptor subfamily 2, group F, member 2 ) Nr3c1 ( nuclear receptor subfamily 3, group C, member 1 ) Nr3c2 ( nuclear receptor subfamily 3, group C, member 2 ) Nr4a1 ( nuclear receptor subfamily 4, group A, member 1 ) Nr4a2 ( nuclear receptor subfamily 4, group A, member 2 ) Nr4a3 ( nuclear receptor subfamily 4, group A, member 3 ) Nr5a1 ( nuclear receptor subfamily 5, group A, member 1 ) Nrep ( neuronal regeneration related protein ) Nrg1 ( neuregulin 1 ) Nrgn ( neurogranin ) Nrip1 ( nuclear receptor interacting protein 1 ) Nrip3 ( nuclear receptor interacting protein 3 ) Nrn1 ( neuritin 1 ) Nrp1 ( neuropilin 1 ) Nrp2 ( neuropilin 2 ) Nrtn ( neurturin ) Nrxn1 ( neurexin I ) Nrxn2 ( neurexin II ) Nsdhl ( NAD(P) dependent steroid dehydrogenase-like ) Nsf ( N-ethylmaleimide sensitive fusion protein ) Nsg1 ( neuron specific gene family member 1 ) Nsmf ( NMDA receptor synaptonuclear signaling and neuronal migration factor ) Ntf3 ( neurotrophin 3 ) Ntf5 ( neurotrophin 5 ) Ntn1 ( netrin 1 ) Ntng1 ( netrin G1 ) Ntng2 ( netrin G2 ) Ntrk1 ( neurotrophic tyrosine kinase, receptor, type 1 ) Ntrk2 ( neurotrophic tyrosine kinase, receptor, type 2 ) Ntrk3 ( neurotrophic tyrosine kinase, receptor, type 3 ) Nts ( neurotensin ) Ntsr1 ( neurotensin receptor 1 ) Ntsr2 ( neurotensin receptor 2 ) Nucb2 ( nucleobindin 2 ) Nudt2 ( nudix (nucleoside diphosphate linked moiety X)-type motif 2 ) Numb ( numb gene homolog (Drosophila) ) Numbl ( numb-like ) Nxph4 ( neurexophilin 4 ) Oasl2 ( 2-5 oligoadenylate synthetase-like 2 ) Odc1 ( ornithine decarboxylase, structural 1 ) Odz3 ( odd Oz/ten-m homolog 3 (Drosophila) ) Ogfr ( opioid growth factor receptor ) Olfm1 ( olfactomedin 1 ) Olfml2b ( olfactomedin-like 2B ) Olfr732 ( olfactory receptor 732 ) Olfr734 ( olfactory receptor 734 ) Olig1 ( oligodendrocyte transcription factor 1 ) Olig2 ( oligodendrocyte transcription factor 2 ) Olig3 ( oligodendrocyte transcription factor 3 ) Oma1 ( OMA1 homolog, zinc metallopeptidase (S. cerevisiae) ) Ophn1 ( oligophrenin 1 ) Opn3 ( opsin 3 ) Opn4 ( opsin 4 (melanopsin) ) Oprd1 ( opioid receptor, delta 1 ) Oprk1 ( opioid receptor, kappa 1 ) Oprm1 ( opioid receptor, mu 1 ) Osbpl1a ( oxysterol binding protein-like 1A ) Otof ( otoferlin ) Otp ( orthopedia homolog (Drosophila) ) Otx1 ( orthodenticle homolog 1 (Drosophila) ) Otx2 ( orthodenticle homolog 2 (Drosophila) ) Oxt ( oxytocin ) Oxtr ( oxytocin receptor ) P287 ( Protein 287 ) P297 ( Protein 297 ) P2rx7 ( purinergic receptor P2X, ligand-gated ion channel, 7 ) P2ry1 ( purinergic receptor P2Y, G-protein coupled 1 ) P2ry12 ( purinergic receptor P2Y, G-protein coupled 12 ) P468 ( Protein 468 ) Pacsin3 ( protein kinase C and casein kinase substrate in neurons 3 ) Pafah1b1 ( platelet-activating factor acetylhydrolase, isoform 1b, subunit 1 ) Pak1 ( p21 protein (Cdc42/Rac)-activated kinase 1 ) Pak6 ( p21 protein (Cdc42/Rac)-activated kinase 6 ) Pam ( peptidylglycine alpha-amidating monooxygenase ) Panx2 ( pannexin 2 ) Pard6a ( par-6 (partitioning defective 6,) homolog alpha (C. elegans) ) Park2 ( parkin ) Park7 ( Parkinson disease (autosomal recessive, early onset) 7 ) Pax2 ( paired box gene 2 ) Pax3 ( paired box gene 3 ) Pax6 ( paired box gene 6 ) Pax7 ( paired box gene 7 ) Pbk ( PDZ binding kinase ) Pbx1 ( pre B-cell leukemia transcription factor 1 ) Pbx3 ( pre B-cell leukemia transcription factor 3 ) Pcbd1 ( pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 ) Pcbp3 ( poly(rC) binding protein 3 ) Pcdh17 ( protocadherin 17 ) Pcdh20 ( protocadherin 20 ) Pcdh9 ( protocadherin 9 ) Pcdha1 ( protocadherin alpha 1 ) Pcdha10 ( protocadherin alpha 10 ) Pcdha11 ( protocadherin alpha 11 ) Pcdha13 ( protocadherin alpha 13 ) Pcdha4 ( protocadherin alpha 4 ) Pcdha6 ( protocadherin alpha 6 ) Pcdha7 ( protocadherin alpha 7 ) Pcdha9 ( protocadherin alpha 9 ) Pcdhgb1 ( protocadherin gamma subfamily B, 1 ) Pcnt ( pericentrin (kendrin) ) Pcp2 ( Purkinje cell protein 2 (L7) ) Pcp4 ( Purkinje cell protein 4 ) Pcp4l1 ( Purkinje cell protein 4-like 1 ) pcsk1 ( proprotein convertase subtilisin/kexin type 1 ) Pcsk5 ( proprotein convertase subtilisin/kexin type 5 ) Pcsk9 ( proprotein convertase subtilisin/kexin type 9 ) Pde10a ( phosphodiesterase 10A ) Pde1a ( phosphodiesterase 1A, calmodulin-dependent ) Pde1b ( phosphodiesterase 1B, Ca2+-calmodulin dependent ) Pde1c ( phosphodiesterase 1C ) Pde3b ( phosphodiesterase 3B, cGMP-inhibited ) Pde4a ( phosphodiesterase 4A, cAMP specific ) Pde4b ( phosphodiesterase 4B, cAMP specific ) Pde4d ( phosphodiesterase 4D, cAMP specific ) Pde7b ( phosphodiesterase 7B ) Pde8b ( phosphodiesterase 8B ) Pde9a ( phosphodiesterase 9A ) Pdgfra ( platelet derived growth factor receptor, alpha polypeptide ) Pdgfrb ( platelet derived growth factor receptor, beta polypeptide ) Pdp1 ( pyruvate dehyrogenase phosphatase catalytic subunit 1 ) Pdyn ( prodynorphin ) Pdzk1ip1 ( PDZK1 interacting protein 1 ) Pdzrn3 ( PDZ domain containing RING finger 3 ) Pecam1 ( platelet/endothelial cell adhesion molecule 1 ) Peg10 ( paternally expressed 10 ) Peg3 ( paternally expressed 3 ) Penk ( preproenkephalin ) Per1 ( period homolog 1 (Drosophila) ) Per2 ( period circadian clock 2 ) Pex5l ( peroxisomal biogenesis factor 5-like ) Pfkp ( phosphofructokinase, platelet ) Pgr ( progesterone receptor ) Pgrmc1 ( progesterone receptor membrane component 1 ) Phactr1 ( phosphatase and actin regulator 1 ) Phactr4 ( phosphatase and actin regulator 4 ) Phb ( prohibitin ) Phf6 ( PHD finger protein 6 ) Phip ( pleckstrin homology domain interacting protein ) Phox2a ( paired-like homeobox 2a ) Phox2b ( paired-like homeobox 2b ) PI31 ( proteasome inhibitor hPI31 ) Pias3 ( protein inhibitor of activated STAT 3 ) Pik3r1 ( phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha) ) Pip5k1a ( phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha ) Pirt ( phosphoinositide-interacting regulator of transient receptor potential channels ) Pisd ( phosphatidylserine decarboxylase ) Pitpnc1 ( RIKEN cDNA 1110020B03 gene ) Pitpnm2 ( phosphatidylinositol transfer protein, membrane-associated 2 ) Pitx1 ( paired-like homeodomain transcription factor 1 ) Pitx2 ( paired-like homeodomain transcription factor 2 ) Pitx3 ( paired-like homeodomain transcription factor 3 ) Pkd1 ( polycystic kidney disease 1 homolog ) Pkd2 ( polycystic kidney disease 2 ) Pkp4 ( plakophilin 4 ) Pla2g7 ( phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) ) Plagl1 ( pleiomorphic adenoma gene-like 1 ) Plcb1 ( phospholipase C, beta 1 ) Plcxd2 ( phosphatidylinositol-specific phospholipase C, X domain containing 2 ) Pld3 ( phospholipase D family, member 3 ) Plekha2 ( pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 ) Plekhb1 ( pleckstrin homology domain containing, family B (evectins) member 1 ) Plekhg1 ( pleckstrin homology domain containing, family G (with RhoGef domain) member 1 ) Plk2 ( polo-like kinase 2 ) Plk3 ( polo-like kinase 3 ) Plp1 ( proteolipid protein (myelin) 1 ) Plxdc1 ( plexin domain containing 1 ) Plxdc2 ( plexin domain containing 2 ) Plxna1 ( plexin A1 ) plxna2 ( plexin A2 ) Plxna3 ( plexin A3 ) Plxna4 ( plexin A4 ) Plxnb2 ( plexin B2 ) Plxnc1 ( plexin C1 ) Plxnd1 ( plexin D1 ) Pmch ( pro-melanin-concentrating hormone ) Pmp22 ( peripheral myelin protein 22 ) Pnck ( Pregnanc y upregulated non-ubiquitously expressed CaM kinase ) Pnkd ( paroxysmal nonkinesiogenic dyskinesia ) Pnma2 ( Paraneoplastic antigen MA2 ) Pnmt ( phenylethanolamine-N-methyltransferase ) Pnoc ( prepronociceptin ) Pnpla6 ( patatin-like phospholipase domain containing 6 ) Podxl2 ( podocalyxin-like 2 ) Pogz ( pogo transposable element with ZNF domain ) Polr1d ( polymerase (RNA) I polypeptide D ) Polr2a ( polymerase (RNA) II (DNA directed) polypeptide A ) Polr3e ( polymerase (RNA) III (DNA directed) polypeptide E ) Polr3k ( polymerase (RNA) III (DNA directed) polypeptide K ) Pomc ( pro-opiomelanocortin-alpha ) PomcDoNotUse ( Proopiomelanocortin ) Pou2f1 ( POU domain, class 2, transcription factor 1 ) Pou3f1 ( POU domain, class 3, transcription factor 1 ) Pou3f2 ( POU domain, class 3, transcription factor 2 ) Pou3f3 ( POU domain, class 3, transcription factor 3 ) Pou3f4 ( POU domain, class 3, transcription factor 4 ) Pou4f1 ( POU domain, class 4, transcription factor 1 ) Pou5f1 ( POU domain, class 5, transcription factor 1 ) Pou6f1 ( POU domain, class 6, transcription factor 1 ) Ppargc1a ( peroxisome proliferative activated receptor, gamma, coactivator 1 alpha ) Ppargc1b ( peroxisome proliferative activated receptor, gamma, coactivator 1 beta ) Ppfia1 ( protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1 ) Ppfia4 ( protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4 ) Ppfibp1 ( PTPRF interacting protein, binding protein 1 (liprin beta 1) ) Ppm1a ( protein phosphatase 1A, magnesium dependent, alpha isoform ) Ppm1e ( protein phosphatase 1E (PP2C domain containing) ) Ppm1j ( protein phosphatase 1J ) Ppp1ca ( protein phosphatase 1, catalytic subunit, alpha isoform ) Ppp1cc ( protein phosphatase 1, catalytic subunit, gamma isoform ) Ppp1r14c ( protein phosphatase 1, regulatory (inhibitor) subunit 14c ) Ppp1r16b ( protein phosphatase 1, regulatory (inhibitor) subunit 16B ) Ppp1r17 ( protein phosphatase 1, regulatory subunit 17 ) Ppp1r1a ( protein phosphatase 1, regulatory (inhibitor) subunit 1A ) Ppp1r1b ( protein phosphatase 1, regulatory (inhibitor) subunit 1B ) Ppp1r1c ( protein phosphatase 1, regulatory (inhibitor) subunit 1C ) Ppp1r2 ( protein phosphatase 1, regulatory (inhibitor) subunit 2 ) Ppp1r7 ( protein phosphatase 1, regulatory (inhibitor) subunit 7 ) Ppp1r9a ( protein phosphatase 1, regulatory (inhibitor) subunit 9A ) Ppp2r2a ( protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform ) Ppp2r2b ( protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform ) Ppp2r2c ( protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform ) Ppp2r2d ( protein phosphatase 2, regulatory subunit B, delta isoform ) Ppp2r5b ( protein phosphatase 2, regulatory subunit B (B56), beta isoform ) Ppp2r5c ( protein phosphatase 2, regulatory subunit B (B56), gamma isoform ) Ppp3ca ( protein phosphatase 3, catalytic subunit, alpha isoform ) Ppp4c ( protein phosphatase 4, catalytic subunit ) Ppp5c ( protein phosphatase 5, catalytic subunit ) Ppp6c ( protein phosphatase 6, catalytic subunit ) Prdx1 ( peroxiredoxin 1 ) Prickle1 ( prickle homolog 1 (Drosophila) ) Prkacb ( protein kinase, cAMP dependent, catalytic, beta ) Prkca ( protein kinase C, alpha ) Prkcb ( protein kinase C, beta ) Prkcb1 ( protein kinase C, beta 1 ) Prkcc ( protein kinase C, gamma ) Prkcd ( protein kinase C, delta ) Prkch ( protein kinase C, eta ) Prkcq ( protein kinase C, theta ) Prmt2 ( protein arginine N-methyltransferase 2 ) Prmt8 ( protein arginine N-methyltransferase 8 ) Prnp ( prion protein ) Prodh ( proline dehydrogenase ) Prok2 ( prokineticin 2 ) Prokr2 ( prokineticin receptor 2 ) Prom1 ( prominin 1 ) Prosapip1 ( ProSAPiP1 protein ) Prox1 ( prospero-related homeobox 1 ) Prph ( peripherin ) Prrx1 ( paired related homeobox 1 ) Prss12 ( protease, serine, 12 neurotrypsin (motopsin) ) Prtg ( protogenin homolog (Gallus gallus) ) Prune ( prune homolog (Drosophila) ) Psen1 ( presenilin 1 ) Psen2 ( presenilin 2 ) Psp ( parotid secretory protein ) Pspn ( persephin ) Ptbp2 ( polypyrimidine tract binding protein 2 ) Ptch1 ( patched homolog 1 ) Ptch2 ( patched homolog 2 ) Ptchd1 ( patched domain containing 1 ) Pten ( phosphatase and tensin homolog ) Ptf1a ( pancreas specific transcription factor, 1a ) Ptgds ( prostaglandin D2 synthase (brain) ) Ptger2 ( prostaglandin E receptor 2 (subtype EP2) ) Pthlh ( Parathyroid hormone-like peptide ) Ptk2 ( PTK2 protein tyrosine kinase 2 ) Ptk2b ( PTK2 protein tyrosine kinase 2 beta ) Ptn ( pleiotrophin ) Ptpn2 ( protein tyrosine phosphatase, non-receptor type 2 ) Ptpn3 ( protein tyrosine phosphatase, non-receptor type 3 ) Ptpn5 ( protein tyrosine phosphatase, non-receptor type 5 ) Ptprc ( protein tyrosine phosphatase, receptor type, C ) Ptprd ( protein tyrosine phosphatase, receptor type, D ) Ptprf ( protein tyrosine phosphatase, receptor type, F ) Ptprk ( protein tyrosine phosphatase, receptor type, K ) Ptpro ( protein tyrosine phosphatase, receptor type, O ) Ptpru ( protein tyrosine phosphatase, receptor type, U ) Ptprz1 ( protein tyrosine phosphatase, receptor type Z, polypeptide 1 ) Pttg1 ( pituitary tumor-transforming gene 1 ) Ptx3 ( pentraxin related gene ) Punc ( putative neuronal cell adhesion molecule ) Pus10 ( pseudouridylate synthase 10 ) Pvalb ( parvalbumin ) Pvrl1 ( poliovirus receptor-related 1 ) Pvrl3 ( poliovirus receptor-related 3 ) Pygb ( brain glycogen phosphorylase ) Pyy ( peptide YY ) Rab37 ( RAB37, member of RAS oncogene family ) Rab39b ( RAB39B, member RAS oncogene family ) Rab3b ( RAB3B, member RAS oncogene family ) Rab5b ( RAB5B, member RAS oncogene family ) Rac1 ( RAS-related C3 botulinum substrate 1 ) Rac3 ( RAS-related C3 botulinum substrate 3 ) Ramp3 ( receptor (calcitonin) activity modifying protein 3 ) Ranbp1 ( RAN binding protein 1 ) Rap1a ( RAS-related protein-1a ) Rap1gds1 ( RAP1, GTP-GDP dissociation stimulator 1 ) Rap2a ( RAS related protein 2a ) Rapgef3 ( Rap guanine nucleotide exchange factor (GEF) 3 ) Rapgef4 ( Rap guanine nucleotide exchange factor (GEF) 4 ) Rapgef5 ( Rap guanine nucleotide exchange factor (GEF) 5 ) Rapsn ( receptor-associated protein of the synapse ) Rarb ( retinoic acid receptor, beta ) Rasa3 ( RAS p21 protein activator 3 ) Rasal1 ( RAS protein activator like 1 (GAP1 like) ) Rasd2 ( RASD family, member 2 ) Rasgef1b ( RasGEF domain family, member 1B ) Rasgrf1 ( RAS protein-specific guanine nucleotide-releasing factor 1 ) Rasgrf2 ( RAS protein-specific guanine nucleotide-releasing factor 2 ) Rasgrp1 ( RAS guanyl releasing protein 1 ) Rasgrp2 ( RAS, guanyl releasing protein 2 ) Rasl11b ( RAS-like, family 11, member B ) Rax ( retina and anterior neural fold homeobox ) Rbms1 ( RNA binding motif, single stranded interacting protein 1 ) Rbp1 ( retinol binding protein 1, cellular ) Rbp4 ( retinol binding protein 4, plasma ) Rcan2 ( regulator of calcineurin 2 ) Rcn1 ( reticulocalbin 1 ) Ref ( Reference Set ) Rel ( reticuloendotheliosis oncogene ) Rell1 ( RELT-like 1 ) Reln ( reelin ) Rerg ( RAS-like, estrogen-regulated, growth-inhibitor ) Resp18 ( regulated endocrine-specific protein 18 ) Rest ( RE1-silencing transcription factor ) Rfng ( RFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase ) Rfx3 ( regulatory factor X, 3 (influences HLA class II expression) ) Rfxank ( regulatory factor X-associated ankyrin-containing protein ) Rgl1 ( ral guanine nucleotide dissociation stimulator,-like 1 ) Rgs10 ( regulator of G-protein signalling 10 ) Rgs11 ( regulator of G-protein signaling 11 ) Rgs12 ( regulator of G-protein signaling 12 ) Rgs14 ( regulator of G-protein signaling 14 ) Rgs16 ( regulator of G-protein signaling 16 ) Rgs17 ( regulator of G-protein signaling 17 ) Rgs2 ( regulator of G-protein signaling 2 ) Rgs20 ( regulator of G-protein signaling 20 ) Rgs3 ( regulator of G-protein signaling 3 ) Rgs4 ( regulator of G-protein signaling 4 ) Rgs5 ( regulator of G-protein signaling 5 ) Rgs7 ( regulator of G protein signaling 7 ) Rgs8 ( regulator of G-protein signaling 8 ) Rgs9 ( regulator of G-protein signaling 9 ) Rhbdl3 ( rhomboid, veinlet-like 3 (Drosophila) ) Rhoa ( ras homolog gene family, member A ) Rhob ( ras homolog gene family, member B ) Rhou ( ras homolog gene family, member U ) Rhov ( ras homolog gene family, member V ) Rhox8 ( reproductive homeobox 8 ) Rif1 ( Rap1 interacting factor 1 homolog (yeast) ) Rlbp1 ( retinaldehyde binding protein 1 ) Rnd1 ( Rho family GTPase 1 ) Rnd2 ( Rho family GTPase 2 ) Rnd3 ( Rho family GTPase 3 ) Robo1 ( roundabout homolog 1 (Drosophila) ) Robo2 ( roundabout homolog 2 (Drosophila) ) Rora ( RAR-related orphan receptor alpha ) Rorb ( RAR-related orphan receptor beta ) RP23-181C16 ( chromosome 3 clone RP23-181C16 ) Rph3a ( rabphilin 3A ) Rpl17 ( ribosomal protein L17 ) Rpl18 ( ribosomal protein L18 ) Rpl3 ( ribosomal protein L3 ) Rpl31 ( ribosomal protein L31 ) Rprm ( reprimo, TP53 dependent G2 arrest mediator candidate ) Rps24 ( ribosomal protein S24 ) Rps25 ( ribosomal protein S25 ) Rps6kb2 ( ribosomal protein S6 kinase, polypeptide 2 ) Rps7 ( ribosomal protein S7 ) Rraga ( Ras-related GTP binding A ) Rragd ( Ras-related GTP binding D ) Rreb1 ( ras responsive element binding protein 1 ) Rspo2 ( R-spondin 2 homolog (Xenopus laevis) ) Rspo3 ( R-spondin 3 homolog (Xenopus laevis) ) Rtn4 ( reticulon 4 ) Rtn4r ( reticulon 4 receptor ) Rtn4rl1 ( reticulon 4 receptor-like 1 ) Rufy3 ( RUN and FYVE domain containing 3 ) Runx1 ( runt related transcription factor 1 ) Runx1t1 ( CBFA2T1 identified gene homolog (human) ) Runx2 ( runt related transcription factor 2 ) Runx3 ( runt related transcription factor 3 ) Rxfp1 ( relaxin/insulin-like family peptide receptor 1 ) Rxfp3 ( relaxin family peptide receptor 3 ) Ryr1 ( ryanodine receptor 1, skeletal muscle ) Ryr2 ( ryanodine receptor 2, cardiac ) Ryr3 ( ryanodine receptor 3 ) S100a10 ( S100 calcium binding protein A10 (calpactin) ) Satb1 ( special AT-rich sequence binding protein 1 ) Satb2 ( special AT-rich sequence binding protein 2 ) Sca1 ( This is a duplicate entry for Atxn1 (Ataxin 1) ) Scand1 ( SCAN domain-containing 1 ) Scg2 ( secretogranin II ) Scg3 ( secretogranin III ) Scn1b ( sodium channel, voltage-gated, type I, beta ) Scn3b ( sodium channel, voltage-gated, type III, beta ) Scn4b ( sodium channel, type IV, beta ) Scnn1a ( sodium channel, nonvoltage-gated, type I, alpha ) Scrn1 ( secernin 1 ) Scrt1 ( scratch homolog 1, zinc finger protein (Drosophila) ) Scrt2 ( Scratch homolog 2 ) Scube1 ( signal peptide, CUB domain, EGF-like 1 ) Scube2 ( signal peptide, CUB domain, EGF-like 2 ) Sdc2 ( syndecan 2 ) Sdc3 ( syndecan 3 ) Sdcbp ( syndecan binding protein ) Sdha ( succinate dehydrogenase complex, subunit A, flavoprotein (Fp) ) Sebox ( SEBOX homeobox ) Selm ( selenoprotein M ) Sema3a ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A ) Sema3b ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B ) Sema3c ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C ) Sema3d ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D ) Sema3e ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E ) Sema3f ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F ) Sema4a ( sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A ) Sema4b ( sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B ) Sema5a ( sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A ) Sema6a ( sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A ) Sema6c ( sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C ) Sema6d ( sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D ) Sema7a ( sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A ) Senp2 ( SUMO/sentrin specific protease 2 ) Senp3 ( SUMO/sentrin specific protease 3 ) Sept3 ( septin 3 ) Sept4 ( septin 4 ) Sept5 ( septin 5 ) Sept6 ( septin 6 ) Sept7 ( septin 7 ) Sepw1 ( selenoprotein W, muscle 1 ) Serf1 ( small EDRK-rich factor 1 ) Serpina3c ( serine (or cysteine) peptidase inhibitor, clade A, member 3C ) Serpina3k ( serine (or cysteine) peptidase inhibitor, clade A, member 3K ) Serpina9 ( serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 ) Serpinb6a ( serine (or cysteine) peptidase inhibitor, clade B, member 6a ) Serpine2 ( Serpine2 serine (or cysteine) proteinase inhibitor, clade E, member 2 ) Serpinh1 ( serine (or cysteine) peptidase inhibitor, clade H, member 1 ) Serpini1 ( serine (or cysteine) peptidase inhibitor, clade I, member 1 ) Sertad4 ( SERTA domain containing 4 ) Sertm1 ( serine rich and transmembrane domain containing 1 ) Sez6 ( seizure related gene 6 ) Sez6l ( seizure related 6 homolog (mouse)-like ) Sez6l2 ( seizure related 6 homolog like 2 ) Sf1 ( splicing factor 1 ) Sfrp1 ( secreted frizzled-related protein 1 ) Sfrp2 ( secreted frizzled-related protein 2 ) Sfrp4 ( secreted frizzled-related protein 4 ) Sfrp5 ( secreted frizzled-related sequence protein 5 ) Sfrs1 ( splicing factor, arginine/serine-rich 1 (ASF/SF2) ) Sgsm1 ( small G protein signaling modulator 1 ) Sh3bgrl2 ( SH3 domain binding glutamic acid-rich protein like 2 ) Sh3bgrl3 ( SH3 domain binding glutamic acid-rich protein-like 3 ) Sh3kbp1 ( SH3-domain kinase binding protein 1 ) Shank3 ( SH3/ankyrin domain gene 3 ) Shf ( Src homology 2 domain containing F ) Shh ( sonic hedgehog ) Sim1 ( single-minded homolog 1 (Drosophila) ) Sipa1l1 ( signal-induced proliferation-associated 1 like 1 ) Sirpa ( signal-regulatory protein alpha ) Sirt2 ( sirtuin 2 (silent mating type information regulation 2, homolog) 2 (S. cerevisiae) ) Six3 ( sine oculis-related homeobox 3 ) Six6 ( sine oculis-related homeobox 6 ) Skil ( SKI-like ) Skor1 ( SKI family transcriptional corepressor 1 ) Skor1 ( SKI family transcriptional corepressor 1 ) Skor2 ( SKI family transcriptional corepressor 2 ) Sla ( src-like adaptor ) Slc10a4 ( solute carrier family 10 (sodium/bile acid cotransporter family), member 4 ) Slc12a5 ( solute carrier family 12, member 5 ) Slc13a3 ( solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 ) Slc16a3 ( solute carrier family 16 (monocarboxylic acid transporters), member 3 ) Slc17a6 ( solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 ) Slc17a7 ( solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 ) Slc17a8 ( solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 ) Slc18a2 ( solute carrier family 18 (vesicular monoamine), member 2 ) Slc18a3 ( solute carrier family 18 (vesicular monoamine), member 3 ) Slc1a1 ( solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 ) Slc1a2 ( solute carrier family 1 (glial high affinity glutamate transporter), member 2 ) Slc1a3 ( solute carrier family 1 (glial high affinity glutamate transporter), member 3 ) Slc1a6 ( solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 ) Slc20a1 ( solute carrier family 20, member 1 ) Slc20a2 ( solute carrier family 20, member 2 ) Slc22a3 ( solute carrier family 22 (organic cation transporter), member 3 ) Slc24a2 ( solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 ) Slc24a3 ( solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 ) Slc25a1 ( solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 ) Slc25a12 ( solute carrier family 25 (mitochondrial carrier, Aralar), member 12 ) Slc25a19 ( solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19 ) Slc25a22 ( solute carrier family 25 (mitochondrial carrier, glutamate), member 22 ) Slc25a4 ( solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 4 ) Slc27a2 ( solute carrier family 27 (fatty acid transporter), member 2 ) Slc29a1 ( solute carrier family 29 (nucleoside transporters), member 1 ) Slc30a3 ( solute carrier family 30 (zinc transporter), member 3 ) Slc32a1 ( solute carrier family 32 (GABA vesicular transporter), member 1 ) Slc33a1 ( solute carrier family 33 (acetyl-CoA transporter), member 1 ) Slc35f1 ( solute carrier family 35, member F1 ) Slc36a1 ( solute carrier family 36 (proton/amino acid symporter), member 1 ) Slc36a2 ( solute carrier family 36 (proton/amino acid symporter), member 2 ) Slc38a7 ( solute carrier family 38, member 7 ) Slc39a14 ( solute carrier family 39 (zinc transporter), member 14 ) Slc39a6 ( solute carrier family 39 (metal ion transporter), member 6 ) Slc41a3 ( solute carrier family 41, member 3 ) Slc4a2 ( solute carrier family 4 (anion exchanger), member 2 ) Slc5a7 ( solute carrier family 5 (choline transporter), member 7 ) Slc6a1 ( solute carrier family 6 (neurotransmitter transporter, GABA), member 1 ) Slc6a11 ( solute carrier family 6 (neurotransmitter transporter, GABA), member 11 ) Slc6a12 ( solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 ) Slc6a15 ( solute carrier family 6 (neurotransmitter transporter), member 15 ) Slc6a2 ( solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 ) Slc6a3 ( solute carrier family 6 (neurotransmitter transporter, dopamine), member 3 ) Slc6a4 ( solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 ) Slc6a5 ( solute carrier family 6 (neurotransmitter transporter, glycine), member 5 ) Slc6a6 ( solute carrier family 6 (neurotransmitter transporter, taurine), member 6 ) Slc6a7 ( solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 ) Slc6a9 ( solute carrier family 6 (neurotransmitter transporter, glycine), member 9 ) Slc7a14 ( solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 ) Slc8a2 ( solute carrier family 8 (sodium/calcium exchanger), member 2 ) Slc9a3r1 ( solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 ) Slco1c1 ( solute carrier organic anion transporter family, member 1c1 ) Slit1 ( slit homolog 1 (Drosophila) ) Slit2 ( slit homolog 2 (Drosophila) ) Slit3 ( slit homolog 3 (Drosophila) ) Slitrk1 ( SLIT and NTRK-like family, member 1 ) Slitrk2 ( SLIT and NTRK-like family, member 2 ) Slitrk3 ( SLIT and NTRK-like family, member 3 ) Slitrk4 ( SLIT and NTRK-like family, member 4 ) Slitrk5 ( SLIT and NTRK-like family, member 5 ) Slitrk6 ( SLIT and NTRK-like family, member 6 ) Smad4 ( MAD homolog 4 (Drosophila) ) Smad6 ( SMAD family member 6 ) Smarca5 ( SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 ) Smarcd2 ( SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 ) Smarce1 ( SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 ) Smn ( survival motor neuron ) Smo ( smoothened homolog (Drosophila) ) Smoc1 ( SPARC related modular calcium binding 1 ) Smoc2 ( SPARC related modular calcium binding 2 ) Smpd1 ( Sphingomyelin phosphodiesdterase 1 ) Smpd3 ( sphingomyelin phosphodiesterase 3, neutral ) Snap25 ( synaptosomal-associated protein 25 ) Snap91 ( synaptosomal-associated protein 91 ) Snca ( synuclein, alpha ) Sncb ( synuclein, beta ) Sncg ( synuclein, gamma ) Snhg11 ( small nucleolar RNA host gene 11 ) Snx17 ( sorting nexin 17 ) Snx5 ( sorting nexin 5 ) Soat2 ( sterol O-acyltransferase 2 ) Sobp ( sine oculis-binding protein homolog (Drosophila) ) Socs6 ( suppressor of cytokine ) Sod1 ( superoxide dismutase 1, soluble ) Soga2 ( SOGA family member 2 ) Sorbs1 ( sorbin and SH3 domain containing 1 ) Sorl1 ( sortilin-related receptor, LDLR class A repeats-containing ) Sort1 ( sortilin 1 ) Sostdc1 ( sclerostin domain containing 1 ) Sox1 ( SRY-box containing gene 1 ) Sox10 ( SRY-box containing gene 10 ) Sox11 ( SRY-box containing gene 11 ) Sox12 ( SRY-box containing gene 12 ) Sox14 ( SRY-box containing gene 14 ) Sox2 ( SRY-box containing gene 2 ) Sox3 ( SRY-box containing gene 3 ) Sox4 ( SRY-box containing gene 4 ) Sox5 ( SRY-box containing gene 5 ) Sox8 ( SRY-box containing gene 8 ) Sox9 ( SRY-box containing gene 9 ) Sp4 ( trans-acting transcription factor 4 ) Sp8 ( trans-acting transcription factor 8 ) Spag5 ( sperm associated antigen 5 ) Spag9 ( sperm associated antigen 9 ) Sparcl1 ( SPARC-like 1 ) Spata13 ( spermatogenesis associated 13 ) Sphkap ( SPHK1 interactor, AKAP domain containing ) Spint2 ( serine protease inhibitor, Kunitz type 2 ) Spock3 ( sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3 ) Spon1 ( spondin 1, (f-spondin) extracellular matrix protein ) Spp1 ( secreted phosphoprotein 1 ) Sprn ( shadow of prion protein ) Spry1 ( sprouty homolog 1 (Drosophila) ) Spry3 ( sprouty homolog 3 (Drosophila) ) Spry4 ( sprouty homolog 4 (Drosophila) ) Sptan1 ( spectrin alpha, non-erythrocytic 1 ) Sqle ( squalene epoxidase ) Srgap1 ( SLIT-ROBO Rho GTPase activating protein 1 ) Srgap2 ( SLIT-ROBO Rho GTPase activating protein 2 ) Srgap3 ( SLIT-ROBO Rho GTPase activating protein 3 ) Srr ( serine racemase ) Srsf5 ( serine/arginine-rich splicing factor 5 ) Srsf7 ( serine/arginine-rich splicing factor 7 ) Ssbp2 ( single-stranded DNA binding protein 2 ) Sst ( somatostatin ) Sstr1 ( somatostatin receptor 1 ) Sstr2 ( somatostatin receptor 2 ) Sstr3 ( somatostatin receptor 3 ) Sstr4 ( somatostatin receptor 4 ) Sstr5 ( somatostatin receptor 5 ) Ssx2ip ( synovial sarcoma, X breakpoint 2 interacting protein ) St3gal1 ( ST3 beta-galactoside alpha-2,3-sialyltransferase 1 ) St6galnac5 ( ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 ) St7 ( Suppression of tumorigenicity 7 ) St8sia2 ( ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 ) St8sia5 ( ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 ) Stard5 ( StAR-related lipid transfer (START) domain containing 5 ) Stard8 ( START domain containing 8 ) Stat3 ( signal transducer and activator of transcription 3 ) Stau1 ( staufen (RNA binding protein) homolog 1 (Drosophila) ) Stau2 ( staufen (RNA binding protein) homolog 2 (Drosophila) ) Steap2 ( six transmembrane epithelial antigen of prostate 2 ) Stk32a ( serine/threonine kinase 32A ) Stmn1 ( stathmin 1 ) Stmn2 ( stathmin-like 2 ) Stra6 ( stimulated by retinoic acid gene 6 ) Strip2 ( striatin interacting protein 2 ) Strn ( striatin, calmodulin binding protein ) Stt3b ( STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) ) Stx1a ( syntaxin 1A (brain) ) Stxbp2 ( syntaxin binding protein 2 ) Stxbp6 ( syntaxin binding protein 6 (amisyn) ) Styk1 ( serine/threonine/tyrosine kinase 1 ) Sucnr1 ( succinate receptor 1 ) Sufu ( suppressor of fused homolog (Drosophila) ) Sulf1 ( sulfatase 1 ) Sulf2 ( sulfatase 2 ) Sult1a1 ( sulfotransferase family 1A, phenol-preferring, member 1 ) Sun2 ( Sad1 and UNC84 domain containing 2 ) Susd2 ( sushi domain containing 2 ) Suv39h1 ( suppressor of variegation 3-9 homolog 1 (Drosophila) ) Sv2a ( synaptic vesicle glycoprotein 2 a ) Sv2b ( synaptic vesicle glycoprotein 2 b ) Sv2c ( synaptic vesicle glycoprotein 2c ) Svet1 ( subventricular expressed transcript 1 ) Svop ( SV2 related protein ) Syndig1l ( synapse differentiation inducing 1 like ) Syngap1 ( synaptic Ras GTPase activating protein 1 homolog (rat) ) Syngr3 ( synaptogyrin 3 ) Synj2 ( synaptojanin 2 ) Synpo ( synaptopodin ) Synpr ( synaptoporin ) Syt1 ( synaptotagmin 1 ) Syt10 ( synaptotagmin X ) Syt13 ( synaptotagmin XIII ) Syt16 ( synaptotagmin XVI ) Syt17 ( synaptotagmin XVII ) Syt2 ( synaptotagmin II ) Syt3 ( synaptotagmin III ) Syt4 ( synaptotagmin IV ) Syt5 ( synaptotagmin V ) Syt6 ( synaptotagmin VI ) Syt7 ( synaptotagmin VII ) Syt9 ( synaptotagmin IX ) Tac1 ( tachykinin 1 ) Tac2 ( tachykinin 2 ) Tacr1 ( tachykinin receptor 1 ) Tacr3 ( tachykinin receptor 3 ) Taf13 ( TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor ) Tagln3 ( transgelin 3 ) Tbc1d8 ( TBC1 domain family, member 8 ) Tbr1 ( T-box brain gene 1 ) Tbx3 ( T-box 3 ) TC1568100 ( TIGR MGI TC1568100 ) Tcf12 ( transcription factor 12 ) Tcf25 ( transcription factor 25 (basic helix-loop-helix) ) Tcf3 ( transcription factor 3 ) Tcf4 ( transcription factor 4 ) Tcf7l2 ( transcription factor 7-like 2, T-cell specific, HMG-box ) Tcrb ( T-cell receptor beta chain ) Tdo2 ( tryptophan 2,3-dioxygenase ) Tef ( thyrotroph embryonic factor ) Tesc ( tescalcin ) Tex261 ( testis expressed gene 261 ) Tfap2b ( transcription factor AP-2 beta ) Tfg ( Trk-fused gene ) Tfpi ( tissue factor pathway inhibitor ) Tgfb2 ( transforming growth factor, beta 2 ) Tgfb3 ( transforming growth factor, beta 3 ) Tgif1 ( TGFB-induced factor homeobox 1 ) Th ( tyrosine hydroxylase ) Thap4 ( THAP domain containing 4 ) Thbs1 ( thrombospondin 1 ) Thbs2 ( thrombospondin 2 ) Thbs3 ( thrombospondin 3 ) Thbs4 ( thrombospondin 4 ) Them6 ( thioesterase superfamily member 6 ) Thra ( thyroid hormone receptor alpha ) Thrap3 ( thyroid hormone receptor associated protein 3 ) Thrsp ( thyroid hormone responsive ) Thsd7a ( thrombospondin, type I, domain containing 7A ) Thsd7b ( thrombospondin, type I, domain containing 7B ) Thy1 ( thymus cell antigen 1, theta ) Tiam1 ( T-cell lymphoma invasion and metastasis 1 ) Tiam2 ( T-cell lymphoma invasion and metastasis 2 ) Timp2 ( tissue inhibitor of metalloproteinase 2 ) Tle1 ( transducin-like enhancer of split 1, homolog of Drosophila E(spl) ) Tle3 ( transducin-like enhancer of split 3, homolog of Drosophila E(spl) ) Tle4 ( transducin-like enhancer of split 4, homolog of Drosophila E(spl) ) Tll1 ( tolloid-like ) Tlx3 ( T cell leukemia, homeobox 3 ) Tm4sf20 ( transmembrane 4 L six family member 20 ) Tm9sf4 ( transmembrane 9 superfamily protein member 4 ) Tmeff1 ( transmembrane protein with EGF-like and two follistatin-like domains 1 ) Tmem145 ( transmembrane protein 145 ) Tmem163 ( transmembrane protein 163 ) Tmem16a ( transmembrane protein 16A ) Tmem16b ( transmembrane protein 16B ) Tmem178 ( transmembrane protein 178 ) Tmem20 ( transmembrane protein 20NM_175507.3 ) Tmem229b ( transmembrane protein 229B ) Tmem230 ( transmembrane protein 230 ) Tmem35 ( transmembrane protein 35 ) Tmem59l ( transmembrane protein 59-like ) Tnc ( tenascin C ) Tnfrsf12a ( tumor necrosis factor receptor superfamily, member 12a ) Tnfrsf19 ( tumor necrosis factor receptor superfamily, member 19 ) Tnip2 ( TNFAIP3 interacting protein 2 ) Tns1 ( tensin 1 ) Top2a ( topoisomerase (DNA) II alpha ) Tor1a ( torsin family 1, member A ) Tor1b ( torsin family 1, member B ) Tox ( thymocyte selection-associated high mobility group box ) Tpbg ( trophoblast glycoprotein ) Tpd52 ( tumor protein D52 ) Tpd52l1 ( tumor protein D52-like 1 ) Tph1 ( tryptophan hydroxylase 1 ) Tph2 ( tryptophan hydroxylase 2 ) Tpm1 ( tropomyosin 1, alpha ) Tppp3 ( tubulin polymerization-promoting protein family member 3 ) Traf4 ( TNF receptor associated factor 4 ) Trappc3 ( trafficking protein particle complex 3 ) Trf ( transferrin ) Trh ( thyrotropin releasing hormone ) Trhr ( thyrotropin releasing hormone receptor ) Trib2 ( tribbles homolog 2 (Drosophila) ) Trim2 ( tripartite motif-containing 2 ) Trim28 ( tripartite motif protein 28 ) Trim9 ( tripartite motif-containing 9 ) Trio ( triple functional domain (PTPRF interacting) ) Trnp1 ( TMF1-regulated nuclear protein 1 ) Trp73 ( Transformation related protein 73 ) Trpa1 ( transient receptor potential cation channel, subfamily A, member 1 ) Trpc2 ( transient receptor potential cation channel, subfamily C, member 2 ) Trpc4 ( transient receptor potential cation channel, subfamily C, member 4 ) Trpc6 ( transient receptor potential cation channel, subfamily C, member 6 ) Trpm8 ( transient receptor potential cation channel, subfamily M, member 8 ) Trps1 ( trichorhinophalangeal syndrome I (human) ) Trpv1 ( transient receptor potential cation channel, subfamily V, member 1 ) Trpv3 ( transient receptor potential cation channel, subfamily V, member 3 ) Trpv4 ( transient receptor potential cation channel, subfamily V, member 4 ) Tsc22d2 ( TSC22 domain family, member 2 ) Tsen34 ( tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae) ) Tspan11 ( tetraspanin 11 ) Tspan14 ( tetraspanin 14 ) Tspan7 ( tetraspanin 7 ) Ttc28 ( tetratricopeptide repeat domain 28 ) Ttc6 ( tetratricopeptide repeat domain 6 ) Ttr ( transthyretin ) Ttyh1 ( tweety homolog 1 (Drosophila) ) Tuba1b ( tubulin, alpha 1B ) Tubb3 ( tubulin, beta 3 class III ) Tubb4a ( tubulin, beta 4A class IVA ) Tubb4b ( tubulin, beta 4B class IVB ) Twist1 ( twist gene homolog 1 (Drosophila) ) Txnip ( thioredoxin interacting protein ) Tyro3 ( TYRO3 protein tyrosine kinase 3 ) Ubash3b ( ubiquitin associated and SH3 domain containing, B ) Ube2n ( ubiquitin-conjugating enzyme E2N ) Ube3a ( ubiquitin protein ligase E3A ) Ubn2 ( ubinuclein 2 ) Ubxn11 ( UBX domain protein 11 ) Uchl1 ( ubiquitin carboxy-terminal hydrolase L1 ) Ucn2 ( urocortin 2 ) Ucn3 ( urocortin 3 ) Ucp2 ( uncoupling protein 2 (mitochondrial, proton carrier) ) Uhmk1 ( U2AF homology motif (UHM) kinase 1 ) Ulk1 ( Unc-51 like kinase 1 (C. elegans) ) Unc5b ( unc-5 homolog B (C. elegans) ) Unc5c ( unc-5 homolog C (C. elegans) ) Unc5d ( unc-5 homolog D (C. elegans) ) Uncx ( UNC homeobox ) Uqcrc1 ( ubiquinol-cytochrome c reductase core protein 1 ) Uso1 ( USO1 vesicle docking factor ) Usp14 ( ubiquitin specific peptidase 14 ) Usp29 ( ubiquitin specific peptidase 29 ) Usp46 ( ubiquitin specific peptidase 46 ) Usp9x ( ubiquitin specific protease 9, X chromosome ) Vamp2 ( vesicle-associated membrane protein 2 ) Vat1 ( vesicle amine transport protein 1 homolog (T californica) ) Vav2 ( vav 2 oncogene ) Vax1 ( ventral anterior homeobox containing gene 1 ) Vb7904 ( Vb79b04.r1 ) Vcam1 ( vascular cell adhesion molecule 1 ) Vcan ( versican ) Vdac1 ( voltage-dependent anion channel 1 ) Vdac2 ( voltage-dependent anion channel 2 ) Vegfa ( vascular endothelial growth factor A ) Vgll2 ( vestigial like 2 homolog (Drosophila) ) Vim ( vimentin ) Vip ( vasoactive intestinal polypeptide ) Vipr2 ( vasoactive intestinal peptide receptor 2 ) Vldlr ( very low density lipoprotein receptor ) Vmn1r206 ( vomeronasal 1 receptor 206 ) Vps13a ( vacuolar protein sorting 13A (yeast) ) Vsnl1 ( visinin-like 1 ) Vsx2 ( visual system homeobox 2 ) Wasf1 ( WAS protein family, member 1 ) Wbscr17 ( Williams-Beuren syndrome chromosome region 17 homolog (human) ) Wdr1 ( WD repeat domain 1 ) Wdr13 ( WD repeat domain 13 ) Wdr46 ( WD repeat domain 46 ) Wdr74 ( WD repeat domain 74 ) Wfs1 ( Wolfram syndrome 1 homolog (human) ) Whrn ( whirlin ) Wif1 ( Wnt inhibitory factor 1 ) Wnk1 ( WNK lysine deficient protein kinase 1 ) Wnt1 ( wingless-related MMTV integration site 1 ) Wnt2b ( wingless related MMTV integration site 2b ) Wnt3 ( wingless-related MMTV integration site 3 ) Wnt3a ( wingless-related MMTV integration site 3A ) Wnt5a ( wingless-related MMTV integration site 5A ) Wnt5b ( wingless-related MMTV integration site 5B ) Wnt7a ( wingless-related MMTV integration site 7A ) Wnt7b ( wingless-related MMTV integration site 7B ) Wnt8b ( wingless related MMTV integration site 8b ) Wnt9b ( wingless-type MMTV integration site 9B ) Wrb ( tryptophan rich basic protein ) Wscd1 ( WSC domain containing 1 ) Wwc1 ( WW, C2 and coiled-coil domain containing 1 ) Xk ( Kell blood group precursor (McLeod phenotype) homolog ) Xpo4 ( exportin 4 ) Yjefn3 ( YjeF N-terminal domain containing 3 ) Ypel4 ( yippee-like 4 (Drosophila) ) Ywhah ( tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide ) Ywhaz ( tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide ) Zbtb18 ( zinc finger and BTB domain containing 18 ) Zbtb20 ( zinc finger and BTB domain containing 20 ) Zcchc12 ( zinc finger, CCHC domain containing 12 ) Zdbf2 ( zinc finger, DBF-type containing 2 ) Zdhhc2 ( zinc finger, DHHC domain containing 2 ) Zdhhc7 ( zinc finger, DHHC domain containing 7 ) Zeb2 ( zinc finger E-box binding homeobox 2 ) Zfhx3 ( zinc finger homeobox 3 ) Zfp385 ( zinc finger protein 385 ) Zfp503 ( zinc finger protein 503 ) Zfp521 ( zinc finger protein 521 ) Zfp532 ( zinc finger protein 532 ) Zfp618 ( zinc fingerprotein 618 ) Zfp804a ( zinc finger protein 804A ) Zfp90 ( zinc finger protein 90 ) Zfpm2 ( zinc finger protein, multitype 2 ) Zic1 ( zinc finger protein of the cerebellum 1 ) Zic2 ( zinc finger protein of the cerebellum 2 ) Zic3 ( zinc finger protein of the cerebellum 3 ) Zic4 ( zinc finger protein of the cerebellum 4 ) Zic5 ( zinc finger protein of the cerebellum 5 ) Zik1 ( zinc finger protein interacting with K protein 1 ) Zim1 ( zinc finger, imprinted 1 ) Zmat4 ( zinc finger, matrin type 4 ) Zmynd11 ( zinc finger, MYND domain containing 11 ) Zscan12 ( zinc finger and SCAN domain containing 12 ) Zwint ( ZW10 interactor ) Zyx ( zyxin )

Access level: Public Access

Enter pw for higher access level: