GENSAT Brain Atlas of Gene Expression in EGFP Transgenic Mice

Gene Progress Tracker, Sat May 25 23:43:19 EDT 2013

Gene name:	glutamate receptor, metabotropic 1
Symbol:	Grm1
Alternative names:	4930455H15Rik, G protein coupled receptor, family C, group 1, member A, G protein-coupled receptor, family C, group 1, member A, Gprc1a, Grm1, Metabotrol Glurl, mGluR1

Jump to any stage of production for this gene
1. BGEM probe info (in situ hybridization)
2. GENSAT gene info
3. BAC Modification & availability
4. Deployment of images to www.gensat.org
5. MMRRC Production: availability of founder lines

1. BGEM probe info (in situ hybridization)

BGEM, total: 1

Probe	aliases	In Situ Run	LinkToBGEM
Grm1	4930455H15Rik, Gprc1a, MGC90744, mGluR1, wobl	10/1/2003	247

2. GENSAT gene info

Almost all of the published expression studies of Grm1 were done in rat or human brain. Our BAC data is consistent with the literature and BGEM in situ data in general. But there are some discrepancies (Species-specific difference could be a factor). 1. in thalamus, staining is present in the ventral and posterior thalamic nuclear groups in the BAC mice, which is consistent with the literature. But the levels of expression are significantly lower. 2. in hypothalamus, only a few, weakly labeled cells are found in the lateral hypothalamic area. 3. In cerebellum, only Purkinje cells are intensely labeled in the BAC mice. Both literature and in situ also detect moderate expression in the IGL. 4. At E15-5, almost no expression in the BAC data. But the in situ clearly shows expression in MOB and some other brain areas. This could be due to the difference in the determination of the gestation data between the two studies.

Current literature references:

PubMed ID
1430307
8182455
7884041

3. BAC Modification & availability

BAC

marker

address

A-homology arm (A-box)
3' Primer

A-homology arm (A-box)
5' Primer

Availability

BX269

EGFP

RP23-432G7

GGTGTGTGAATCAGGTGTGC

GGCGCGCCCAACGCTTCTACCTCCCAAA

Date marked for shipping:	2008-04-07
Shipped?	Y
Available from CHORI?	BX269

4. Deployment of images to www.gensat.org

Batches of images deployed to www.gensat.org, total: 6

age	acquisition technique	orientation	CNS region	Founder Line	Marker	fluorescent?	images
adult	brightfield	Sagittal	Brain	BC25	EGFP	ND	10 images
adult	brightfield	Horizontal	Spinal cord	BC25	EGFP	ND	1 image
P7	brightfield	Sagittal	Brain	BC25	EGFP	ND	11 images
P7	brightfield	Horizontal	Spinal cord	BC25	EGFP	ND	3 images
E15.5	brightfield	Sagittal	Brain	BC25	EGFP	ND	10 images
E15.5	brightfield	Horizontal	Spinal cord	BC25	EGFP	ND	1 image

See all 6 batches of images on gensat.org

5. MMRRC Production: availability of founder lines

strain	Available date	availability	Available products	Founder Expression Comment
STOCK Tg(Grm1-EGFP)BC25Gsat/Mmnc: Details, Order	2005-01-18	Cryo-archive	Mice, Embryos	-

top

Or use gene selection list:

Access level: Public Access