My Album | Anatomy Showcase | Cell Showcase | Daily Showcase | Embryonic Showcase | Confocal Showcase | Retina Project

Search | Search for genes | Search Annotations | Track Progress | Order Mice & BACs | Cre Mice | About

Gene Progress Tracker, Sun May 19 19:09:36 EDT 2013 Gene name: adrenergic receptor, alpha 2c Symbol: Adra2c Alternative names: Adra-2c, alpha2-C4, alpha2C, [a]2C

Jump to any stage of production for this gene 1. BGEM probe info (in situ hybridization) 2. GENSAT gene info 3. BAC Modification & availability 4. Deployment of images to www.gensat.org 5. MMRRC Production: availability of founder lines

1. BGEM probe info (in situ hybridization)

BGEM, total: 1


Probe	aliases	In Situ Run	LinkToBGEM
Adra2c	Adra-2c, [a]2C, alpha2-C4, alpha2C	4/26/2005	1856

2. GENSAT gene info

Gene Support Comment:

The BAC data is consistent with both the literature and BGEM in situ data. Correct expression is observed in caudate putamen, ventral striatum, cerebellum, dentate gyrus and AON. In hippocampus, only scattered cells are labeled in the CA1 region in P7 BAC mice. At E15-5, the expression is confined to MOB, olfactory epithelium and the trigeminal ganglion in BAC data.

Current literature references:

PubMed ID
10336518
9415717
8843087

3. BAC Modification & availability

Modified BACs, total available: 1

BAC	marker	address	A-homology arm (A-box) 3' Primer	A-homology arm (A-box) 5' Primer	Availability
BX1568	EGFP	RP24-82M23	GGTCCTCCCGAGAGCTACGCG	CGACGCGTTGGGAAGCAGAGTGTCCGGGC	Date marked for shipping: 2008-04-07 Shipped? Y Available from CHORI? BX1568

4. Deployment of images to www.gensat.org

Batches of images deployed to www.gensat.org, total: 6


age	acquisition technique	orientation	CNS region	Founder Line	Marker	fluorescent?	images
adult	brightfield	Sagittal	Brain	HZ102	EGFP	Y	10 images
adult	brightfield	Horizontal	Spinal cord	HZ102	EGFP	Y	3 images
P7	brightfield	Sagittal	Brain	HZ102	EGFP	Y	11 images
P7	brightfield	Horizontal	Spinal cord	HZ102	EGFP	Y	3 images
E15.5	brightfield	Sagittal	Brain	HZ102	EGFP	Y	10 images
E15.5	brightfield	Horizontal	Spinal cord	HZ102	EGFP	Y	3 images


See all 6 batches of images on gensat.org

5. MMRRC Production: availability of founder lines

MMRRC Availability:

strain	Available date	availability	Available products	Founder Expression Comment
STOCK Tg(Adra2c-EGFP)HZ102Gsat/Mmucd: Details, Order	2007-11-08	Cryo-archive	Mice, Sperm	-

top

Search for another gene:

Or use gene selection list:

0710001E13Rik ( RIKEN cDNA 0710001E13 gene ) 1110008P14Rik ( RIKEN cDNA 1110008P14 gene ) 1110032E23Rik ( RIKEN cDNA 1110032E23 gene ) 1200009O22Rik ( RIKEN cDNA 1200009O22 gene ) 1500041N16Rik ( RIKEN cDNA 1500041N16 gene ) 1700010C24Rik ( RIKEN cDNA 1700010C24 gene ) 1700019N12Rik ( RIKEN cDNA 1700019N12 gene ) 1700021K02Rik ( RIKEN cDNA 1700021K02 gene ) 1700021K19Rik ( RIKEN cDNA 1700021K19 gene ) 1700027J05Rik ( RIKEN cDNA 1700027J05 gene ) 1700051I12Rik ( RIKEN cDNA 1700051I12 gene ) 1810041L15Rik ( RIKEN cDNA 1810041L15 gene ) 2010300C02Rik ( RIKEN cDNA 2010300C02 gene ) 2210419I08Rik ( RIKEN cDNA 2210419I08 gene ) 2310010M24Rik ( RIKEN cDNA 2310010M24 gene ) 2310022K01Rik ( RIKEN cDNA 2310022K01 gene ) 2310045A20Rik ( RIKEN cDNA 2310045A20 gene ) 2310046K01Rik ( RIKEN cDNA 2310046K01 gene ) 2410002F23Rik ( RIKEN cDNA 2410002F23 gene ) 2410018L13Rik ( RIKEN cDNA 2410018L13 gene ) 2410066E13Rik ( RIKEN cDNA 2410066E13 gene ) 2610200G18Rik ( RIKEN cDNA 2610200G18 gene ) 3110035E14Rik ( RIKEN cDNA 3110035E14 gene ) 3110047P20Rik ( RIKEN cDNA 3110047P20 gene ) 3632451O06Rik ( RIKEN cDNA 3632451O06 gene ) 4632404H22Rik ( RIKEN cDNA 4632404H22 gene ) 4930555G01Rik ( RIKEN cDNA 4930555G01 gene ) 4932418E24Rik ( RIKEN cDNA 4932418E24 gene ) 4933426K21Rik ( RIKEN cDNA 4933426K21 gene ) 5430405G05Rik ( RIKEN cDNA 5430405G05 gene ) 5430432M24Rik ( RIKEN cDNA 5430432M24 gene ) 6330403A02Rik ( RIKEN cDNA 6330403A02 gene ) 6330407J23Rik ( RIKEN cDNA 6330407J23 gene ) 6330514A18Rik ( RIKEN cDNA 6330514A18 gene ) 6430573F11Rik ( RIKEN cDNA 6430573F11 gene ) 8430419L09Rik ( RIKEN cDNA 8430419L09 gene ) 9130024F11Rik ( RIKEN cDNA 9130024F11 gene ) 9130213B05 ( RIKEN cDNA 9130213B05 gene ) 9230117N10Rik ( RIKEN cDNA 9230117N10 gene ) 9330175B01Rik ( RIKEN cDNA 9330175B01 gene ) 9430020K01Rik ( RIKEN cDNA 9430020K01 gene ) 9630033F20Rik ( RIKEN cDNA 9630033F20 gene ) 9930013L23Rik ( RIKEN cDNA 9930013L23 gene ) A230065H16Rik ( RIKEN cDNA A230065H16 gene ) A2bp1 ( ataxin 2 binding protein 1 ) A330102H22Rik ( RIKEN cDNA A330102H22 gene ) A330104H05Rik ( RIKEN cDNA A330104H05 gene ) A830010M20Rik ( RIKEN cDNA A830010M20 gene ) A830029E22Rik ( RIKEN cDNA A830029E22 gene ) A930025D01Rik ( RIKEN cDNA A930025D01 gene ) Aatf ( apoptosis antagonizing transcription factor ) Abat ( 4-aminobutyrate aminotransferase ) Abcb1a ( ATP-binding cassette, sub-family B (MDR/TAP), member 1A ) Abcb1b ( ATP-binding cassette, sub-family B (MDR/TAP), member 1B ) Abcb6 ( ATP-binding cassette, sub-family B (MDR/TAP), member 6 ) Abcc9 ( ATP-binding cassette, sub-family C (CFTR/MRP), member 9 ) Abhd3 ( abhydrolase domain containing 3 ) Abhd4 ( abhydrolase domain containing 4 ) Abhd5 ( abhydrolase domain containing 5 ) Abhd6 ( abhydrolase domain containing 6 ) Abl2 ( v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) ) Ablim1 ( actin-binding LIM protein 1 ) Ablim2 ( actin-binding LIM protein 2 ) Abracl ( ABRA C-terminal like ) Acaa2 ( acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) ) Acadl ( acyl-Coenzyme A dehydrogenase, long-chain ) Accn1 ( amiloride-sensitive cation channel 1, neuronal (degenerin) ) Ace ( angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 ) Ache ( acetylcholinesterase ) Aco2 ( aconitase 2, mitochondrial ) Acsbg1 ( acyl-CoA synthetase bubblegum family member 1 ) Actb ( actin, beta ) Acvr1c ( activin A receptor, type IC ) Acvr2a ( activin receptor IIA ) Acvrl1 ( activin A receptor, type II-like 1 ) Adam11 ( a disintegrin and metallopeptidase domain 11 ) Adam23 ( a disintegrin and metallopeptidase domain 23 ) Adamts19 ( a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19 ) Adamts2 ( a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2 ) Adamts8 ( a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8 ) Adarb1 ( adenosine deaminase, RNA-specific, B1 ) Adcy1 ( adenylate cyclase 1 ) Adcy2 ( adenylate cyclase 2 ) Adcy5 ( adenylate cyclase 5 ) Adcy8 ( adenylate cyclase 8 ) Adcy9 ( adenylate cyclase 9 ) Adcyap1 ( adenylate cyclase activating polypeptide 1 ) Adk ( adenosine kinase ) Adora2a ( adenosine A2a receptor ) Adra1a ( adrenergic receptor, alpha 1a ) Adra1d ( adrenergic receptor, alpha 1d ) Adra2a ( adrenergic receptor, alpha 2a ) Adra2c ( adrenergic receptor, alpha 2c ) AF529169 ( cDNA sequence AF529169 ) Aff3 ( AF4/FMR2 family, member 3 ) Agrp ( agouti related protein ) Agt ( angiotensinogen (serpin peptidase inhibitor, clade A, member 8) ) Agtpbp1 ( ATP/GTP binding protein 1 ) Agtr1a ( angiotensin II receptor, type 1a ) Agtr2 ( angiotensin II receptor, type 2 ) Agxt2l1 ( alanine-glyoxylate aminotransferase 2-like 1 ) Ahi1 ( Abelson helper integration site ) Ahnak2 ( AHNAK nucleoprotein 2 ) AI317237 ( expressed sequence AI317237 ) AI427515 ( expressed sequence AI427515 ) AI507211 ( expressed sequence AI507211 ) AI593442 ( expressed sequence AI593442 ) AI606473 ( expressed sequence AI606473 ) AI790298 ( espressed sequence A1790298 ) AI836003 ( expressed sequence AI836003 ) AI849226 ( expressed sequence AI849226 ) Ajap1 ( adherens junction associated protein 1 ) Ak4 ( adenylate kinase 4 ) Akap12 ( A kinase (PRKA) anchor protein (gravin) 12 ) Akap5 ( A kinase (PRKA) anchor protein 5 ) Akap9 ( A kinase (PRKA) anchor protein (yotiao) 9 ) Akr1c18 ( aldo-keto reductase family 1, member C18 ) Akt3 ( thymoma viral proto-oncogene 3 ) Aldh1a1 ( aldehyde dehydrogenase family 1, subfamily A1 ) Aldh1l1 ( aldehyde dehydrogenase 1 family, member L1 ) Aldh7a1 ( aldehyde dehydrogenase family 7, member A1 ) Aldoc ( aldolase C, fructose-bisphosphate ) Alg2 ( asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase) ) Alk ( anaplastic lymphoma kinase ) Als2 ( amyotrophic lateral sclerosis 2 (juvenile) ) Amfr ( autocrine motility factor receptor ) Amigo1 ( adhesion molecule with Ig like domain 1 ) Amigo2 ( adhesion molecule with Ig like domain 2 ) Angpt2 ( angiopoietin 2 ) Ank ( progressive ankylosis ) Ank1 ( ankyrin 1, erythroid ) Ank2 ( ankyrin 2, brain ) Ankrd34b ( ankyrin repeat domain 34B ) Ankrd43 ( ankyrin repeat domain 43 ) Anxa2 ( annexin A2 ) Anxa4 ( annexin A4 ) Anxa5 ( annexin A5 ) Ap2b1 ( adaptor-related protein complex 2, beta 1 subunit ) Apba1 ( amyloid beta (A4) precursor protein binding, family A, member 1 ) Api5 ( apoptosis inhibitor 5 ) Apod ( apolipoprotein D ) Apoe ( apolipoprotein E ) App ( amyloid beta (A4) precursor protein ) Aqp4 ( aquaporin 4 ) Ar ( androgen receptor ) Arc ( activity regulated cytoskeletal-associated protein ) Arf6 ( ADP-ribosylation factor 6 ) Arhgap25 ( Rho GTPase activating protein 25 ) Arhgap33 ( Rho GTPase activating protein 33 ) Arhgap5 ( Rho GTPase activating protein 5 ) Arhgdib ( Rho, GDP dissociation inhibitor (GDI) beta ) Arhgdig ( Rho GDP dissociation inhibitor (GDI) gamma ) Arhgef17 ( Rho guanine nucleotide exchange factor (GEF) 17 ) Arhgef6 ( Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 ) Arhgef7 ( Rho guanine nucleotide exchange factor (GEF7) ) Arl4c ( ADP-ribosylation factor-like 4C ) Arl6ip1 ( ADP-ribosylation factor-like 6 interacting protein 1 ) Arntl ( aryl hydrocarbon receptor nuclear translocator-like ) Arpp21 ( cyclic AMP-regulated phosphoprotein, 21 ) Artn ( artemin ) Arvcf ( armadillo repeat gene deleted in velo-cardio-facial syndrome ) Arx ( aristaless related homeobox ) Asb4 ( ankyrin repeat and SOCS box-containing 4 ) Ascl1 ( achaete-scute complex homolog 1 (Drosophila) ) Asic4 ( acid-sensing (proton-gated) ion channel family member 4 ) Aspm ( asp (abnormal spindle)-like, microcephaly associated (Drosophila) ) Astn1 ( astrotactin 1 ) Astn2 ( astrotactin 2 ) Atg4c ( autophagy related 4C, cysteine peptidase ) Atic ( 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase ) Atm ( ataxia telangiectasia mutated homolog (human) ) Atn1 ( atrophin 1 ) Atoh1 ( atonal homolog 1 (Drosophila) ) Atoh4 ( atonal homolog 4 ) Atp1a1 ( ATPase, Na+/K+ transporting, alpha 1 polypeptide ) Atp1b1 ( ATPase, Na+/K+ transporting, beta 1 polypeptide ) Atp2a2 ( ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 ) Atp5a1 ( ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1 ) Atp5j2 ( ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2 ) Atp6v1b2 ( ATPase, H+ transporting, lysosomal V1 subunit B2 ) Atp8b3 ( ATPase, Class I, type 8B, member 3 ) Atpif1 ( ATPase inhibitory factor 1 ) Atxn1 ( ataxin 1 ) Auts2 ( autism susceptibility candidate 2 ) Auxillin ( Auxillin gene ) Avil ( advillin ) Avp ( arginine vasopressin ) Avpr1a ( arginine vasopressin receptor 1A ) Avpr1b ( arginine vasopressin receptor 1B ) B2m ( beta-2 microglobulin ) B3galt2 ( UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 ) B3gat1 ( beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) ) B3gat2 ( beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) ) B430201A12Rik ( RIKEN cDNA B430201A12 gene ) Bace1 ( beta-site APP cleaving enzyme 1 ) Bace2 ( beta-site APP-cleaving enzyme 2 ) Bahcc1 ( BAH domain and coiled-coil containing 1 ) Baiap2 ( brain-specific angiogenesis inhibitor 1-associated protein 2 ) Baiap3 ( BAI1-associated protein 3 ) Bambi ( BMP and activin membrane-bound inhibitor, homolog (Xenopus laevis) ) Barhl1 ( BarH-like 1 (Drosophila) ) Basp1 ( brain abundant, membrane attached signal protein 1 ) Baz2a ( bromodomain adjacent to zinc finger domain, 2A ) BC005537 ( cDNA sequence BC005537 ) Bcan ( brevican ) Bcar1 ( breast cancer anti-estrogen resistance 1 ) Bcat1 ( branched chain aminotransferase 1, cytosolic ) Bcl11b ( B-cell leukemia/lymphoma 11B ) Bcl2l11 ( BCL2-like 11 (apoptosis facilitator) ) Bcl2l2 ( Bcl2-like2 ) Bcl6 ( B-cell leukemia/lymphoma 6 ) BCL6B ( B-cell CLL/lymphoma 6, member B ) Bdnf ( brain derived neurotrophic factor ) Beclin ( Beclin ) Becn1 ( beclin 1, autophagy related ) Bend5 ( BEN domain containing 5 ) Bend6 ( BEN domain containing 6 ) Bhlhe22 ( basic helix-loop-helix family, member e22 ) Bhlhe40 ( basic helix-loop-helix family, member e40 ) Bhlhe41 ( basic helix-loop-helix family, member e41 ) Birc1a ( baculoviral IAP repeat-containing 1a ) Bmi1 ( B lymphoma Mo-MLV insertion region 1 ) Bmp1 ( bone morphogenetic protein 1 ) Bmp3 ( bone morphogenetic protein 3 ) Bmp4 ( bone morphogenetic protein 4 ) Bmp6 ( bone morphogenetic protein 6 ) Bmp7 ( bone morphogenetic protein 7 ) Bmpr1a ( bone morphogenetic protein receptor, type 1A ) Bnip3 ( BCL2/adenovirus E1B interacting protein 3 ) Bok ( Bcl-2-related ovarian killer protein ) Brca1 ( breast cancer 1 ) Bsx ( brain specific homeobox ) Btbd14a ( BTB (POZ) domain containing 14A ) Btbd17 ( BTB (POZ) domain containing 17 ) Btbd3 ( BTB (POZ) domain containing 3 ) Btg1 ( B cell translocation gene 1, anti-proliferative ) Btg2 ( B cell translocation gene 2, anti-proliferative ) Btg3 ( B cell translocation gene 3 ) Bubblegum ( Bubblegum ) C030003D03Rik ( RIKEN cDNA C030003D03 gene ) C130021I20Rik ( Riken cDNA C130021I20 gene ) C130060K24Rik ( RIKEN cDNA C130060K24 gene ) C1ql2 ( complement component 1, q subcomponent-like 2 ) C1ql3 ( C1q-like 3 ) C230001G10 ( Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230001G10 product:unknown EST, full insert sequence. ) C2cd2l ( C2 calcium-dependent domain containing 2-like ) C330002I19Rik ( RIKEN cDNA C330002I19 gene ) C330027C09Rik ( RIKEN cDNA C330027C09 gene ) C630035N08Rik ( RIKEN cDNA C630035N08 gene ) C730048E16Rik ( RIKEN cDNA C730048E16 gene ) C79127 ( expressed sequence C79127 ) Cables1 ( CDK5 and Abl enzyme substrate 1 ) Cabp7 ( calcium binding protein 7 ) Cachd1 ( cache domain containing 1 ) Cacna1g ( calcium channel, voltage-dependent, T type, alpha 1G subunit ) Cacna1h ( calcium channel, voltage-dependent, T type, alpha 1H subunit ) Cacna1i ( calcium channel, voltage-dependent, alpha 1I subunit ) Cacna2d1 ( calcium channel, voltage-dependent, alpha2/delta subunit 1 ) Cacnb1 ( calcium channel, voltage-dependent, beta 1 subunit ) Cacnb4 ( calcium channel, voltage-dependent, beta 4 subunit ) Cacng3 ( calcium channel, voltage-dependent, gamma subunit 3 ) Cacng5 ( calcium channel, voltage-dependent, gamma subunit 5 ) Cacng7 ( calcium channel, voltage-dependent, gamma subunit 7 ) Cacng8 ( calcium channel, voltage-dependent, gamma subunit 8 ) Cadm1 ( Cell adhesion molecule 1 ) Cadps ( Ca2+-dependent secretion activator ) Cadps2 ( Ca2+-dependent activator protein for secretion 2 ) Calb1 ( calbindin 1 ) Calb2 ( calbindin 2 ) Calbmut ( Calbindin-mut PCE1 ) Calca ( calcitonin/calcitonin-related polypeptide, alpha ) Calcb ( calcitonin-related polypeptide, beta ) Calcr ( calcitonin receptor ) Calm2 ( calmodulin 2 ) Caln1 ( calneuron 1 ) Calu ( calumenin ) Camk1d ( calcium/calmodulin-dependent protein kinase ID ) Camk1g ( calcium/calmodulin-dependent protein kinase I gamma ) Camk2a ( calcium/calmodulin-dependent protein kinase II alpha ) Camk2d ( calcium/calmodulin-dependent protein kinase II, delta ) Camk2g ( calcium/calmodulin-dependent protein kinase II gamma ) Camk4 ( calcium/calmodulin-dependent protein kinase IV ) Camkk1 ( calcium/calmodulin-dependent protein kinase kinase 1, alpha ) Camkk2 ( calcium/calmodulin-dependent protein kinase kinase 2, beta ) Camkv ( CaM kinase-like vesicle-associated ) Cap2 ( CAP, adenylate cyclase-associated protein, 2 (yeast) ) Capn3 ( calpain 3 ) Capns1 ( calpain, small subunit 1 ) Car11 ( carbonic anhydrase 11 ) Car12 ( carbonic anyhydrase 12 ) Car3 ( carbonic anhydrase 3 ) Car8 ( carbonic anhydrase 8 ) Card6 ( caspase recruitment domain family, member 6 ) Cartpt ( CART prepropeptide ) Cask ( calcium/calmodulin-dependent serine protein kinase (MAGUK family) ) Casp8 ( caspase 8 ) Casp9 ( caspase 9 ) Casr ( calcium-sensing receptor ) Cbfa2t3h ( core-binding factor, runt domain, alpha subunit 2; translocated to, 3 homolog (human) ) Cbln1 ( cerebellin 1 precursor protein ) Cbln2 ( cerebellin 2 precursor protein ) Cbln3 ( cerebellin 3 precursor protein ) Cbln4 ( cerebellin 4 precursor protein ) Cbx5 ( chromobox 5 ) Ccdc163 ( coiled-coil domain containing 163 ) Ccdc3 ( coiled-coil domain containing 3 ) Cck ( cholecystokinin ) Cckar ( cholecystokinin A receptor ) Cckbr ( cholecystokinin B receptor ) Ccna2 ( cyclin A2 ) Ccnd1 ( cyclin D1 ) Ccnd2 ( cyclin D2 ) Ccne1 ( cyclin E1 ) Ccne2 ( cyclin E2 ) Ccsap ( centriole, cilia and spindle associated protein ) Cd200 ( Cd200 antigen ) Cd200r1 ( CD200 receptor 1 ) CD209a ( CD209a antigen ) Cd247 ( CD247 antigen ) Cd24a ( CD24a antigen ) Cd34 ( CD34 antigen ) Cd4 ( CD4 antigen ) Cd47 ( CD47 antigen (Rh-related antigen, integrin-associated signal transducer) ) Cd63 ( CD63 antigen ) Cd68 ( CD68 antigen ) Cd82 ( CD82 antigen ) Cdc27 ( cell division cycle 27 ) Cdc42bpg ( CDC42 binding protein kinase gamma (DMPK-like) ) Cdc42ep4 ( CDC42 effector protein (Rho GTPase binding) 4 ) Cdc45 ( cell division cycle 45 ) Cdc6 ( cell division cycle 6 ) Cdh1 ( cadherin 1 ) Cdh10 ( cadherin 10 ) Cdh11 ( cadherin 11 ) Cdh13 ( cadherin 13 ) Cdh2 ( cadherin 2 ) Cdh20 ( cadherin 20 ) Cdh23 ( cadherin 23 (otocadherin) ) Cdh24 ( cadherin-like 24 ) Cdh3 ( cadherin 3 ) Cdh4 ( cadherin 4 ) Cdh6 ( cadherin 6 ) Cdh8 ( cadherin 8 ) Cdh9 ( cadherin 9 ) Cdhr1 ( cadherin-related family member 1 ) Cdk17 ( cyclin-dependent kinase 17 ) Cdk4 ( cyclin-dependent kinase 4 ) Cdk5 ( cyclin-dependent kinase 5 ) Cdk5r1 ( cyclin-dependent kinase 5, regulatory subunit 1 (p35) ) Cdk5r2 ( cyclin-dependent kinase 5, regulatory subunit 2 (p39) ) Cdk5rap2 ( CDK5 regulatory subunit associated protein 2 ) Cdk6 ( cyclin-dependent kinase 6 ) Cdkn1a ( cyclin-dependent kinase inhibitor 1A (P21) ) Cdkn1b ( cyclin-dependent kinase inhibitor 1B ) Cdkn1c ( cyclin-dependent kinase inhibitor 1C (P57) ) Cdkn2a ( cyclin-dependent kinase inhibitor 2A ) Cdkn2c ( cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) ) Cdkn2d ( cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) ) Cdon ( cell adhesion molecule-related/down-regulated by oncogenes ) Cdr2 ( cerebellar degeneration-related 2 ) Celf6 ( CUGBP, Elav-like family member 6 ) Cep290 ( centrosomal protein 290 ) Cerk ( ceramide kinase ) Cfh ( complement component factor h ) Cgrp ( calcitonin gene-related peptide ) Chat ( choline acetyltransferase ) Chd7 ( chromodomain helicase DNA binding protein 7 ) Chgb ( chromogranin B ) Chl1 ( cell adhesion molecule with homology to L1CAM ) Chn1 ( chimerin (chimaerin) 1 ) Chn2 ( chimerin (chimaerin) 2 ) Chordc1 ( cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1 ) Chrd ( chordin ) Chrm1 ( cholinergic receptor, muscarinic 1, CNS ) Chrm2 ( cholinergic receptor, muscarinic 2, cardiac ) Chrm3 ( cholinergic receptor, muscarinic 3, cardiac ) Chrm4 ( cholinergic receptor, muscarinic 4 ) Chrm5 ( cholinergic receptor, muscarinic 5 ) Chrna2 ( cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal) ) Chrna3 ( cholinergic receptor, nicotinic, alpha polypeptide 3 ) Chrna4 ( cholinergic receptor, nicotinic, alpha polypeptide 4 ) Chrna5 ( cholinergic receptor, nicotinic, alpha polypeptide 5 ) Chrna6 ( cholinergic receptor, nicotinic, alpha polypeptide 6 ) Chrna7 ( cholinergic receptor, nicotinic, alpha polypeptide 7 ) Chrna9 ( cholinergic receptor, nicotinic, alpha polypeptide 9 ) Chrnb2 ( cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal) ) Chrnb3 ( cholinergic receptor, nicotinic, beta polypeptide 3 ) Chrnb4 ( cholinergic receptor, nicotinic, beta polypeptide 4 ) Chst15 ( carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 ) Chst2 ( carbohydrate sulfotransferase 2 ) Chst8 ( carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 ) Cic ( capicua homolog (Drosophila) ) Cisd1 ( CDGSH iron sulfur domain 1 ) Cit ( citron ) Cited1 ( Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 ) Cited2 ( Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 ) Ckb ( creatine kinase, brain ) Ckm ( creatine kinase, muscle ) Ckmt1 ( creatine kinase, mitochondrial 1, ubiquitous ) Clca3 ( chloride channel calcium activated 3 ) Clcn1 ( chloride channel 1 ) Clcn5 ( chloride channel 5 ) Cldn1 ( claudin 1 ) Cldn2 ( claudin 2 ) Cldn5 ( claudin 5 ) Clic5 ( chloride intracellular channel 5 ) Clic6 ( chloride intracellular channel 6 ) Clock ( circadian locomotor output cycles kaput ) Clptm1l ( CLPTM1-like ) Clu ( clusterin ) Clvs2 ( clavesin 2 ) Cmas ( cytidine monophospho-N-acetylneuraminic acid synthetase ) Cmbl ( carboxymethylenebutenolidase-like (Pseudomonas) ) Cmtm5 ( CKLF-like MARVEL transmembrane domain containing 5 ) Cnga2 ( cyclic nucleotide gated channel alpha 2 ) Cnnm2 ( cyclin M2 ) Cnp ( 2,3-cyclic nucleotide 3 phosphodiesterase ) Cnr1 ( cannabinoid receptor 1 (brain) ) Cntf ( ciliary neurotrophic factor ) Cntfr ( ciliary neurotrophic factor receptor ) Cntn1 ( contactin 1 ) Cntn2 ( contactin 2 ) Cntn3 ( contactin 3 ) Cntn6 ( contactin 6 ) Cntnap1 ( contactin associated protein-like 1 ) Cntnap2 ( contactin associated protein-like 2 ) Coch ( coagulation factor C homolog (Limulus polyphemus) ) Col12a1 ( procollagen, type XII, alpha 1 ) Col18a1 ( collagen, type XVIII, alpha 1 ) Col1a1 ( collagen, type I, alpha 1 ) col24a1 ( procollagen, type XXIV, alpha 1 ) Col25a1 ( procollagen, type XXV, alpha 1 ) Col3a1 ( collagen, type III, alpha 1 ) Col6a1 ( collagen, type VI, alpha 1 ) Col9a1 ( procollagen, type IX, alpha 1 ) Col9a3 ( procollagen, type IX, alpha 3 ) Colgalt2 ( collagen beta(1-O)galactosyltransferase 2 ) Comp ( cartilage oligomeric matrix protein ) Comt ( catechol-O-methyltransferase ) Cort ( cortistatin ) Cox4i1 ( Cytochrome c oxidase subunit IV isoform 1 ) Cox6a2 ( Cytochrome c oxidase, subunit VI a, polypeptide 2 ) Cox7a2 ( cytochrome c oxidase, subunit VIIa 2 ) Cpe ( carboxypeptidase E ) Cpeb3 ( cytoplasmic polyadenylation element binding protein 3 ) Cplx1 ( complexin 1 ) Cplx3 ( complexin 3 ) Cpne5 ( copine V ) Cpne6 ( copine VI ) Cpne7 ( copine VII ) Cpt1a ( carnitine palmitoyltransferase 1a, liver ) Crabp1 ( cellular retinoic acid binding protein I ) Creb1 ( cAMP responsive element binding protein 1 ) Crh ( corticotropin releasing hormone ) Crhr1 ( corticotropin releasing hormone receptor 1 ) Crhr2 ( corticotropin releasing hormone receptor 2 ) Crim1 ( cysteine rich transmembrane BMP regulator 1 (chordin like) ) Crip2 ( cysteine rich protein 2 ) Crk ( v-crk sarcoma virus CT10 oncogene homolog (avian) ) Crkl ( v-crk sarcoma virus CT10 oncogene homolog (avian)-like ) Crlf1 ( cytokine receptor-like factor 1 ) Crxos1 ( EST AA606869 ) Cryab ( crystallin, alpha B ) Crym ( crystallin, mu ) Csdc2 ( cold shock domain containing C2, RNA binding ) Csf2rb2 ( colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage) ) Csnk1d ( casein kinase 1, delta ) Csnk1e ( casein kinase 1, epsilon ) Csnk1g1 ( casein kinase 1, gamma 1 ) Csnk1g3 ( casein kinase 1, gamma 3 ) Cst3 ( cystatin C ) Ctgf ( connective tissue growth factor ) Ctnna1 ( catenin (cadherin associated protein), alpha 1 ) Ctnnb1 ( catenin (cadherin associated protein), beta 1 ) Ctnnd1 ( catenin (cadherin associated protein), delta 1 ) Ctsk ( cathepsin K ) Ctxn1 ( cortexin 1 ) Cugbp2 ( CUG triplet repeat, RNA binding protein 2 ) Cux1 ( cut-like homeobox 1 ) Cux2 ( cut-like homeobox 2 ) Cx3cl1 ( chemokine (C-X3-C motif) ligand 1 ) Cx3cr1 ( chemokine (C-X3-C) receptor 1 ) Cxcl11 ( chemokine (C-X-C motif) ligand 11 ) Cxcl12 ( chemokine (C-X-C motif) ligand 12 ) Cxcl12duplicate ( Cxcl12 duplicate ) Cxcl13 ( chemokine (C-X-C motif) ligand 13 ) Cxcl14 ( chemokine (C-X-C motif) ligand 14 ) Cxcr4 ( chemokine (C-X-C motif) receptor 4 ) Cxcr7 ( chemokine (C-X-C motif) receptor 7 ) Cxxc4 ( CXXC finger 4 ) Cyb561 ( cytochrome b-561 ) Cyfip2 ( cytoplasmic FMR1 interacting protein 2 ) Cyld ( cylindromatosis (turban tumor syndrome) ) Cyp11a1 ( cytochrome P450, family 11, subfamily a, polypeptide 1 ) Cyp19a1 ( cytochrome P450, family 19, subfamily a, polypeptide 1 ) Cyp26b1 ( cytochrome P450, family 26, subfamily b, polypeptide 1 ) Cyp39a1 ( cytochrome P450, family 39, subfamily a, polypeptide 1 ) Cyp4v3 ( cytochrome P450, family 4, subfamily v, polypeptide 3 ) Cyp7b1 ( cytochrome P450, family 7, subfamily b, polypeptide 1 ) Cyr61 ( cysteine rich protein 61 ) D14Ertd171e ( DNA segment, Chr 14, ERATO Doi 171, expressed ) D330050I23Rik ( RIKEN cDNA D330050I23 gene ) D630045J12Rik ( RIKEN cDNA D630045J12 gene ) D6Wsu176e ( DNA segment, Chr 6, Wayne State University 176, expressed ) D8Ertd738e ( DNA segment, Chr 8, ERATO Doi 738, expressed ) D930035P11 ( Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:D930035P11 product:unknown EST, full insert sequence ) Dab1 ( disabled homolog 1 (Drosophila) ) Dact2 ( dapper homolog 2, antagonist of beta-catenin (xenopus) ) Dap ( death-associated protein ) Dap3 ( death associated protein 3 ) Darc ( Duffy blood group, chemokine receptor ) Dbh ( dopamine beta hydroxylase ) Dbi ( diazepam binding inhibitor ) Dbp ( D site albumin promoter binding protein ) Dbx1 ( developing brain homeobox 1 ) Dbx2 ( developing brain homeobox 2 ) Dcc ( deleted in colorectal carcinoma ) Dcdc2a ( doublecortin domain containing 2a ) Dcdc5 ( doublecortin domain containing 5 ) Dclk1 ( doublecortin-like kinase 1 ) Dclk3 ( doublecortin-like kinase 3 ) Dcn ( decorin ) Dct ( dopachrome tautomerase ) Dctn1 ( dynactin 1 ) Dcx ( doublecortin ) Ddc ( dopa decarboxylase ) Ddc8 ( testis specific protein, Ddc8 ) Ddit4l ( DNA-damage-inducible transcript 4-like ) Ddr1 ( discoidin domain receptor family, member 1 ) Ddr2 ( discoidin domain receptor family, member 2 ) Depdc6 ( DEP domain containing 6 ) Dgcr14 ( DiGeorge syndrome critical region gene 14 ) Dgcr6 ( DiGeorge syndrome critical region gene 6 ) Dgcr8 ( DiGeorge syndrome critical region gene 8 ) Dgkb ( diacylglycerol kinase, beta ) Dgkh ( diacylglycerol kinase, eta ) Dhcr24 ( 24-dehydrocholesterol reductase ) Dhrs3 ( dehydrogenase/reductase (SDR family) member 3 ) Dhx57 ( DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 ) diap3 ( diaphanous homolog 3 (Drosophila) ) Dkk3 ( dickkopf homolog 3 (Xenopus laevis) ) Dld ( dihydrolipoamide dehydrogenase ) Dlg1 ( discs, large homolog 1 (Drosophila) ) Dlg2 ( discs, large homolog 2 (Drosophila) ) Dlg3 ( discs, large homolog 3 (Drosophila) ) Dlg4 ( discs, large homolog 4 (Drosophila) ) Dlgap1 ( discs, large (Drosophila) homolog-associated protein 1 ) Dlgap2 ( discs, large (Drosophila) homolog-associated protein 2 ) Dlk1 ( delta-like 1 homolog (Drosophila) ) Dll1 ( delta-like 1 (Drosophila) ) Dlx1 ( distal-less homeobox 1 ) Dlx2 ( distal-less homeobox 2 ) Dlx3 ( distal-less homeobox 3 ) Dlx5 ( distal-less homeobox 5 ) Dlx6 ( distal-less homeobox 6 ) Dmbx1 ( diencephalon/mesencephalon homeobox 1 ) Dmrt3 ( Doublesex and mab-3 transcription factor 3 ) Dmtf1 ( cyclin D binding myb-like transcription factor 1 ) Dnajb1 ( DnaJ (Hsp40) homolog, subfamily B, member 1 ) Dnajc12 ( DnaJ (Hsp40) homolog, subfamily C, member 12 ) Dnalc4 ( dynein, axonemal, light chain 4 ) Dner ( delta/notch-like EGF-related receptor ) Dnm2 ( dynamin 2 ) Dnmt1 ( DNA methyltransferase (cytosine-5) 1 ) Dnmt3a ( DNA methyltransferase 3A ) Doc2a ( double C2, alpha ) Doc2b ( double C2, beta ) Doc2g ( double C2, gamma ) Dock10 ( dedicator of cytokinesis 10 ) Dock7 ( dedicator of cytokinesis 7 ) Dok5 ( docking protein 5 ) Dpp10 ( dipeptidylpeptidase 10 ) Dpysl3 ( dihydropyrimidinase-like 3 ) Dpysl5 ( dihydropyrimidinase-like 5 ) Drd1a ( dopamine receptor D1A ) Drd2 ( dopamine receptor D2 ) Drd3 ( dopamine receptor D3 ) Drd4 ( dopamine receptor D4 ) Drd5 ( dopamine receptor D5 ) Dsp ( desmoplakin ) Dtna ( dystrobrevin alpha ) Dtx4 ( deltex 4 homolog (Drosophila) ) Dtymk ( deoxythymidylate kinase ) Dusp1 ( dual specificity phosphatase 1 ) Dusp14 ( dual specificity phosphatase 14 ) Dusp16 ( dual specificity phosphatase 16 ) Dusp3 ( dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) ) Dusp5 ( dual specificity phosphatase 5 ) Dusp6 ( dual specificity phosphatase 6 ) Dynll1 ( dynein light chain LC8-type 1 ) Dyrk1a ( dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a ) Dyx1c1 ( dyslexia susceptibility 1 candidate 1 homolog (human) ) Dzip1 ( DAZ interacting protein 1 ) E2f8 ( E2F transcription factor 8 ) Eag2 ( potassium voltage-gated channel, subfamily H (eag-related), member 5duplicate ) Ebf1 ( early B-cell factor 1 ) Ebf2 ( early B cell factor 2 ) Ebf3 ( early B cell factor 3 ) Ecel1 ( endothelin converting enzyme-like 1 ) Echdc2 ( enoyl Coenzyme A hydratase domain containing 2 ) Ect2 ( ect2 oncogene ) Ednrb ( endothelin receptor type B ) Eed ( embryonic ectoderm development ) Eef1a1 ( eukaryotic translation elongation factor 1 alpha 1 ) Eef1g ( eukaryotic translation elongation factor 1 gamma ) Efna1 ( ephrin A1 ) Efna2 ( ephrin A2 ) Efna3 ( ephrin A3 ) Efna5 ( ephrin A5 ) Efnb1 ( ephrin B1 ) Efnb2 ( ephrin B2 ) Efnb3 ( ephrin B3 ) Efr3a ( EFR3 homolog A (S. cerevisiae) ) Efs ( embryonal Fyn-associated substrate ) EG545864 ( EG545864 predicted gene ) Egr1 ( early growth response 1 ) Ehmt1 ( euchromatic histone methyltransferase 1 ) Eif1 ( eukaryotic translation initiation factor 1 ) Eif1ax ( eukaryotic translation initiation factor 1A, X-linked ) Eif3h ( eukaryotic translation initiation factor 3, subunit H ) Eif4e3 ( eukaryotic translation initiation factor 4E member 3 ) Eif4g1 ( eukaryotic translation initiation factor 4, gamma 1 ) Eif4g2 ( eukaryotic translation initiation factor 4, gamma 2 ) Elavl2 ( ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) ) Elavl3 ( ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) ) Elavl4 ( ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) ) Elfn1 ( leucine rich repeat and fibronectin type III, extracellular 1 ) Elk1 ( ELK1, member of ETS oncogene family ) Elk3 ( ELK3, member of ETS oncogene family ) Ell3 ( elongation factor RNA polymerase II-like 3 ) Elmo1 ( engulfment and cell motility 1, ced-12 homolog (C. elegans) ) Elovl3 ( elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 ) Elovl6 ( ELOVL family member 6, elongation of long chain fatty acids (yeast) ) Eltd1 ( EGF, latrophilin seven transmembrane domain containing 1 ) Emb ( embigin ) Emcn ( endomucin ) Emp1 ( epithelial membrane protein 1 ) Emx1 ( empty spiracles homeobox 1 ) Emx2 ( empty spiracles homeobox 2 ) En1 ( engrailed 1 ) En2 ( engrailed 2 ) Enah ( enabled homolog (Drosophila) ) Enc1 ( ectodermal-neural cortex 1 ) Endod1 ( endonuclease domain containing 1 ) Eno1 ( enolase 1, alpha non-neuron ) Eno2 ( enolase 2, gamma neuronal ) Enpp2 ( ectonucleotide pyrophosphatase/phosphodiesterase 2 ) Entpd3 ( ectonucleoside triphosphate diphosphohydrolase 3 ) Entpd4 ( ectonucleoside triphosphate diphosphohydrolase 4 ) Eomes ( eomesodermin homolog (Xenopus laevis) ) Epb41 ( erythrocyte protein band 4.1 ) Epb41l1 ( erythrocyte protein band 4.1-like 1 ) Epb41l2 ( erythrocyte protein band 4.1-like 2 ) Epb41l3 ( erythrocyte protein band 4.1-like 3 ) Epb49 ( erythrocyte protein band 4.9 ) Epc1 ( enhancer of polycomb homolog 1 (Drosophila) ) Epha1 ( Eph receptor A1 ) Epha2 ( Eph receptor A2 ) Epha3 ( Eph receptor A3 ) Epha4 ( Eph receptor A4 ) Epha5 ( Eph receptor A5 ) Epha6 ( Eph receptor A6 ) Epha7 ( Eph receptor A7 ) Epha8 ( Eph receptor A8 ) Ephb1 ( Eph receptor B1 ) Ephb2 ( Eph receptor B2 ) Ephb6 ( Eph receptor B6 ) Eps8 ( epidermal growth factor receptor pathway substrate 8 ) Eps8l2 ( EPS8-like 2 ) Epyc ( epiphycan ) Erbb4 ( v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) ) Erp29 ( endoplasmic reticulum protein 29 ) Errfi1 ( ERBB receptor feedback inhibitor 1 ) Esr1 ( estrogen receptor 1 (alpha) ) Esr2 ( estrogen receptor 2 (beta) ) Esrra ( estrogen related receptor, alpha ) Esyt3 ( extended synaptotagmin-like protein 3 ) Etl4 ( enhancer trap locus 4 ) Etv1 ( ets variant gene 1 ) Etv5 ( ets variant gene 5 ) Etv6 ( ets variant gene 6 (TEL oncogene) ) Evx1 ( even skipped homeotic gene 1 homolog ) Evx2 ( even skipped homeotic gene 2 homolog ) Eya1 ( eyes absent 1 homolog (Drosophila) ) F2r ( coagulation factor II (thrombin) receptor ) Faah ( fatty acid amide hydrolase ) Fabp3 ( fatty acid binding protein 3, muscle and heart ) Fabp7 ( fatty acid binding protein 7, brain ) Fam131a ( family with sequence similarity 131, member A ) Fam171b ( family with sequence similarity 171, member B ) Fam20a ( family with sequence similarity 20, member A ) Fam21 ( family with sequence similarity 21 ) Fam43a ( family with sequence similarity 43, member A ) Fam49a ( family with sequence similarity 49, member A ) Fam65b ( family with sequence similarity 65, member B ) Fam81a ( family with sequence similarity 81, member A ) Fam84a ( family with sequence similarity 84, member A ) Farp1 ( FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived) ) Fat3 ( FAT tumor suppressor homolog 3 (Drosophila) ) Fbxl5 ( F-box and leucine-rich repeat protein 5 ) Fbxo32 ( F-box protein 32 ) Fcer1g ( Fc receptor, IgE, high affinity I, gamma polypeptide ) Fem1a ( feminization 1 homolog a (C. elegans) ) Fev ( FEV (ETS oncogene family) ) Fezf1 ( Fez family zinc finger 1 ) Fezf2 ( Fez family zinc finger 2 ) Fgd5 ( FYVE, RhoGEF and PH domain containing 5 ) Fgf1 ( fibroblast growth factor 1 ) Fgf10 ( fibroblast growth factor 10 ) Fgf13 ( fibroblast growth factor 13 ) Fgf14 ( fibroblast growth factor 14 ) Fgf15 ( fibroblast growth factor 15 ) Fgf17 ( fibroblast growth factor 17 ) Fgf3 ( fibroblast growth factor 3 ) Fgf8 ( fibroblast growth factor 8 ) Fgfr1 ( fibroblast growth factor receptor 1 ) Fgfr2 ( fibroblast growth factor receptor 2 ) Fgfr3 ( fibroblast growth factor receptor 3 ) Fgfr4 ( fibroblast growth factor receptor 4 ) Fhdc1 ( FH2 domain containing 1 ) Fhit ( fragile histidine triad gene ) Fhod3 ( formin homology 2 domain containing 3 ) Fign ( fidgetin ) Fkbp1b ( FK506 binding protein 1b ) Fkbp2 ( FK506 binding protein 2 ) Fkbp3 ( FK506 binding protein 3 ) Flrt1 ( fibronectin leucine rich transmembrane protein 1 ) Flrt2 ( fibronectin leucine rich transmembrane protein 2 ) Flrt3 ( fibronectin leucine rich transmembrane protein 3 ) Fmr1 ( fragile X mental retardation syndrome 1 ) Fn1 ( fibronectin 1 ) Fos ( FBJ osteosarcoma oncogene ) Fosb ( FBJ osteosarcoma oncogene B ) Foxa1 ( forkhead box A1 ) Foxa2 ( Forkhead box A2. ) Foxg1 ( forkhead box G1 ) Foxi1 ( forkhead box I1 ) Foxi2 ( forkhead box I2 ) Foxl1 ( forkhead box L1 ) Foxm1 ( forkhead box M1 ) Foxo1 ( forkhead box O1 ) Foxo3a ( forkhead box O3a ) Foxp1 ( forkhead box P1 ) Foxp2 ( forkhead box P2 ) FoxP3 ( forkhead box p3 ) Foxp4 ( forkhead box P4 ) Frat1 ( frequently rearranged in advanced T cell lymphomas ) Frem2 ( Fras1 related extracellular matrix protein 2 ) Fryl ( furry homolog-like (Drosophila) ) Frzb ( frizzled-related protein ) Fst ( follistatin ) Fstl1 ( follistatin-like 1 ) Fstl5 ( follistatin-like 5 ) Fubp1 ( far upstream element (FUSE) binding protein 1 ) Fxyd6 ( FXYD domain-containing ion transport regulator 6 ) Fxyd7 ( FXYD domain-containing ion transport regulator 7 ) Fyn ( Fyn proto-oncogene ) Fzd10 ( frizzled homolog 10 (Drosophila) ) Fzd2 ( frizzled homolog 2 (Drosophila) ) Fzd3 ( frizzled homolog 3 (Drosophila) ) Fzd5 ( frizzled homolog 5 (Drosophila) ) Fzd8 ( frizzled homolog 8 (Drosophila) ) Fzd9 ( frizzled homolog 9 (Drosophila) ) Gaa ( glucosidase, alpha, acid ) Gabarapl1 ( gamma-aminobutyric acid (GABA) A receptor-associated protein-like 1 ) Gabbr1 ( gamma-aminobutyric acid (GABA) B receptor, 1 ) Gabbr2 ( gamma-aminobutyric acid (GABA) B receptor 2 ) Gabra1 ( gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 1 ) Gabra2 ( gamma-aminobutyric acid (GABA) A receptor, subunit alpha 2 ) Gabra4 ( gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 4 ) Gabra5 ( gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 5 ) Gabra6 ( gamma-aminobutyric acid (GABA) A receptor, subunit alpha 6 ) Gabrb2 ( gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 ) Gabrb3 ( gamma-aminobutyric acid (GABA-A) receptor, subunit beta 3 ) Gabrd ( gamma-aminobutyric acid (GABA-A) receptor, subunit delta ) Gabre ( gamma-aminobutyric acid (GABA) A receptor, subunit epsilon ) Gabrg1 ( gamma-aminobutyric acid (GABA) A receptor, subunit gamma 1 ) Gabrg2 ( gamma-aminobutyric acid (GABA) A receptor, subunit gamma 2 ) Gabrq ( gamma-aminobutyric acid (GABA-A) receptor, subunit theta ) Gabrr2 ( gamma-aminobutyric acid (GABA-C) receptor, subunit rho 2 ) Gabrr3 ( gamma-aminobutyric acid (GABA) receptor, rho 3 ) Gad1 ( glutamic acid decarboxylase 1 ) Gad2 ( glutamic acid decarboxylase 2 ) Gal ( galanin ) Galnt1 ( UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 ) Galnt10 ( UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 ) Galnt5 ( UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 ) Galnt9 ( UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 ) Galntl1 ( UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1 ) Galr1 ( galanin receptor 1 ) Galr2 ( galanin receptor 2 ) Galr3 ( galanin receptor 3 ) Gap43 ( growth associated protein 43 ) Gapdh ( glyceraldehyde-3-phosphate dehydrogenase ) Gas1 ( growth arrest specific 1 ) Gas7 ( growth arrest specific 7 ) Gata6 ( GATA binding protein 6 ) Gbas ( glioblastoma amplified sequence ) Gbe1 ( glucan (1,4-alpha-), branching enzyme 1 ) Gbx2 ( gastrulation brain homeobox 2 ) Gch1 ( GTP cyclohydrolase 1 ) Gchfr ( GTP cyclohydrolase I feedback regulator ) Gck ( glucokinase ) Gcm2 ( glial cells missing homolog 2 (Drosophila) ) Gda ( guanine deaminase ) Gdf10 ( growth differentiation factor 10 ) Gdf7 ( growth differentiation factor 7 ) Gdnf ( glial cell line derived neurotrophic factor ) Gfap ( glial fibrillary acidic protein ) Gfra1 ( glial cell line derived neurotrophic factor family receptor alpha 1 ) Gfra2 ( glial cell line derived neurotrophic factor family receptor alpha 2 ) Ghsr ( growth hormone secretagogue receptor ) Gipc2 ( GIPC PDZ domain containing family, member 2 ) Gja1 ( gap junction protein, alpha 1 ) Gjb1 ( gap junction membrane channel protein beta 1 ) Gjc1 ( gap junction protein, gamma 1 ) Gjd2 ( gap junction protein, delta 2 ) Glce ( glucuronyl C5-epimerase ) Gldc ( glycine decarboxylase ) Gli1 ( GLI-Kruppel family member GLI1 ) Gli2 ( GLI-Kruppel family member GLI2 ) Gli3 ( GLI-Kruppel family member GLI3 ) Glp1r ( glucagon-like peptide 1 receptor ) Glra1 ( glycine receptor, alpha 1 subunit ) Glra2 ( glycine receptor, alpha 2 subunit ) Glra3 ( glycine receptor, alpha 3 subunit ) Glrb ( glycine receptor, beta subunit ) Gls ( glutaminase ) Glud1 ( glutamate dehydrogenase 1 ) Gnal ( guanine nucleotide binding protein, alpha stimulating, olfactory type ) Gnao1 ( guanine nucleotide binding protein, alpha o ) Gnas ( GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus ) Gnb4 ( guanine nucleotide binding protein (G protein), beta 4 ) Gng10 ( guanine nucleotide binding protein (G protein), gamma 10 ) Gng12 ( guanine nucleotide binding protein (G protein), gamma 12 ) Gng13 ( guanine nucleotide binding protein (G protein), gamma 13 ) Gng2 ( guanine nucleotide binding protein (G protein), gamma 2 subunit ) Gng3 ( guanine nucleotide binding protein (G protein), gamma 3 ) Gng4 ( guanine nucleotide binding protein (G protein), gamma 4 ) Gng5 ( guanine nucleotide binding protein (G protein), gamma 5 ) Gng7 ( guanine nucleotide binding protein (G protein), gamma 7 ) Gopc ( golgi associated PDZ and coiled-coil motif containing ) Gp1bb ( glycoprotein Ib, beta polypeptide ) Gpc1 ( Glypican 1 ) Gpc3 ( glypican 3 ) Gpc4 ( glypican 4 ) Gphn ( gephyrin ) Gpm6a ( glycoprotein m6a ) Gpr101 ( G protein-coupled receptor 101 ) Gpr12 ( G-protein coupled receptor 12 ) Gpr123 ( G protein-coupled receptor 123 ) Gpr139 ( G protein-coupled receptor 139 ) Gpr151 ( G protein-coupled receptor 151 ) Gpr155 ( G protein-coupled receptor 155 ) Gpr158 ( G protein-coupled receptor 158 ) Gpr161 ( G protein-coupled receptor 161 ) Gpr165 ( G protein-coupled receptor 165 ) Gpr171 ( G protein-coupled receptor 171 ) Gpr176 ( G protein-coupled receptor 176 ) Gpr21 ( G protein-coupled receptor 21 ) Gpr26 ( G protein-coupled receptor 26 ) Gpr27 ( G protein-coupled receptor 27 ) Gpr30 ( G protein-coupled receptor 30 ) Gpr37 ( G protein-coupled receptor 37 ) Gpr37l1 ( G protein-coupled receptor 37-like 1 ) Gpr4 ( G protein-coupled receptor 4 ) Gpr50 ( G-protein-coupled receptor 50 ) Gpr56 ( G protein-coupled receptor 56 ) Gpr6 ( G protein-coupled receptor 6 ) Gpr63 ( G protein-coupled receptor 63 ) Gpr68 ( G protein-coupled receptor 68 ) Gpr83 ( G protein-coupled receptor 83 ) Gpr88 ( G-protein coupled receptor 88 ) Gprc5b ( G protein-coupled receptor, family C, group 5, member B ) Gprc5c ( G protein-coupled receptor, family C, group 5, member C ) Gprc5d ( G protein-coupled receptor, family C, group 5, member D ) Gprin3 ( GPRIN family member 3 ) Gpsm1 ( G-protein signalling modulator 1 (AGS3-like, C. elegans) ) GpX3 ( Glutathione peroxidase 3 ) Grb10 ( growth factor receptor bound protein 10 ) Grhl1 ( transcription factor CP2-like 2 ) Gria1 ( glutamate receptor, ionotropic, AMPA1 (alpha 1) ) Gria2 ( glutamate receptor, ionotropic, AMPA2 (alpha 2) ) Grid1 ( glutamate receptor, ionotropic, delta 1 ) Grid2 ( glutamate receptor, ionotropic, delta 2 ) Grid2ip ( glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1 ) Grik1 ( glutamate receptor, ionotropic, kainate 1 ) Grik2 ( glutamate receptor, ionotropic, kainate 2 (beta 2) ) Grik3 ( glutamate receptor, ionotropic, kainate 3 ) Grik4 ( glutamate receptor, ionotropic, kainate 4 ) Grik5 ( glutamate receptor, ionotropic, kainate 5 ) Grin1 ( glutamate receptor, ionotropic, NMDA1 (zeta 1) ) Grin2a ( glutamate receptor, ionotropic, NMDA2A (epsilon 1) ) Grin2c ( glutamate receptor, ionotropic, NMDA2C (epsilon 3) ) Grin2d ( glutamate receptor, ionotropic, NMDA2D (epsilon 4) ) Grin3b ( glutamate receptor, ionotropic, NMDA3B ) Grm1 ( glutamate receptor, metabotropic 1 ) Grm2 ( glutamate receptor, metabotropic 2 ) Grm3 ( glutamate receptor, metabotropic 3 ) Grm4 ( glutamate receptor, metabotropic 4 ) Grm5 ( glutamate receptor, metabotropic 5 ) Grm6 ( glutamate receptor, metabotropic 6 ) Grm8 ( glutamate receptor, metabotropic 8 ) Grn ( granulin ) Grp ( gastrin releasing peptide ) Grpr ( gastrin releasing peptide receptor ) Grtp1 ( GH regulated TBC protein 1 ) Gsc ( goosecoid homeobox ) Gsc2 ( goosecoid homebox 2 ) Gsg1l ( GSG1-like ) Gsn ( gelsolin ) Gsx1 ( GS homeobox 1 ) Gsx2 ( GS homeobox 2 ) Gtf2h4 ( general transcription factor II H, polypeptide 4 ) Gtf2i ( general transcription factor II I ) Gucy1a3 ( guanylate cyclase 1, soluble, alpha 3 ) Gucy2c ( guanylate cyclase 2c ) H2-D1 ( histocompatibility 2, D region locus 1 ) H2-K1 ( histocompatibility 2, K1, K region ) H2-L ( histocompatibility 2, D region ) H2-T10 ( histocompatibility 2, T region locus 10 ) H2-T22 ( histocompatibility 2, T region locus 22 ) H2-T23 ( histocompatibility 2, T region locus 23 ) H2afz ( H2A histone family, member Z ) H3f3a ( H3 histone, family 3A ) Hap1 ( huntingtin-associated protein 1 ) Hax1 ( HS1 binding protein ) Hbegf ( heparin-binding EGF-like growth factor ) Hcfc1 ( host cell factor C1 ) Hcfc2 ( host cell factor C2 ) Hcn1 ( hyperpolarization-activated, cyclic nucleotide-gated K+ 1 ) Hcn2 ( hyperpolarization-activated, cyclic nucleotide-gated K+ 2 ) Hcn3 ( hyperpolarization-activated, cyclic nucleotide-gated K+ 3 ) Hcn4 ( hyperpolarization-activated, cyclic nucleotide-gated K+ 4 ) Hcn4duplicate ( Hcn4 duplicate ) Hcrt ( hypocretin ) Hcrtr1 ( hypocretin (orexin) receptor 1 ) Hcrtr2 ( hypocretin (orexin) receptor 2 ) Hdac11 ( histone deacetylase 11 ) Hdac9 ( histone deacetylase 9 ) Hdc ( histidine decarboxylase ) Herc3 ( hect domain and RLD 3 ) Hes1 ( hairy and enhancer of split 1 (Drosophila) ) Hes5 ( hairy and enhancer of split 5 (Drosophila) ) Hes6 ( hairy and enhancer of split 6 (Drosophila) ) Hey1 ( hairy/enhancer-of-split related with YRPW motif 1 ) Hey2 ( hairy/enhancer-of-split related with YRPW motif 2 ) Heyl ( hairy/enhancer-of-split related with YRPW motif-like ) Hgf ( hepatocyte growth factor ) Hgs ( HGF-regulated tyrosine kinase substrate ) Hhip ( Hedgehog-interacting protein ) Hipk2 ( homeodomain interacting protein kinase 2 ) Hira ( histone cell cycle regulation defective homolog A (S. cerevisiae) ) Hivep2 ( human immunodeficiency virus type I enhancer binding protein 2 ) Hlf ( hepatic leukemia factor ) Hmgcs1 ( 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 ) Hmgn2 ( high mobility group nucleosomal binding domain 2 ) Hmgn3 ( high mobility group nucleosomal binding domain 3 ) Hmx3 ( H6 homeobox 3 ) Hnrnpab ( heterogeneous nuclear ribonucleoprotein A/B ) Hnrph3 ( heterogeneous nuclear ribonucleoprotein H3 ) Hnrpul1 ( heterogeneous nuclear ribonucleoprotein U-like 1 ) Hnt ( neurotrimin ) Homer1 ( homer homolog 1 (Drosophila) ) Homer2 ( homer homolog 2 (Drosophila) ) Homer3 ( homer homolog 3 (Drosophila) ) Hoxa5 ( homeobox A5 ) Hoxa9 ( homeo box A9 ) Hoxc10 ( homeobox C10 ) Hoxd10 ( homeobox D10 ) Hpcal1 ( hippocalcin-like 1 ) Hpcal4 ( hippocalcin-like 4 ) Hprt1 ( hypoxanthine guanine phosphoribosyl transferase 1 ) Hpse ( heparanase ) Hrasls ( HRAS-like suppressor ) Hrh1 ( histamine receptor H 1 ) Hrh2 ( histamine receptor H2 ) Hrh3 ( histamine receptor H 3 ) Hs6st2 ( heparan sulfate 6-O-sulfotransferase 2 ) Hsd11b1 ( hydroxysteroid 11-beta dehydrogenase 1 ) Hspa12a ( heat shock protein 12A ) Hspa12b ( heat shock protein 12B ) Hspb1 ( heat shock protein 1 ) Hspb8 ( heat shock protein 8 ) Htr1a ( 5-hydroxytryptamine (serotonin) receptor 1A ) Htr1b ( 5-hydroxytryptamine (serotonin) receptor 1B ) Htr1d ( 5-hydroxytryptamine (serotonin) receptor 1D ) Htr1f ( 5-hydroxytryptamine (serotonin) receptor 1F ) Htr2a ( 5-hydroxytryptamine (serotonin) receptor 2A ) HTR2Ahuman ( 5-hydroxytryptamine (serotonin) receptor 2A (Human) ) Htr2b ( 5-hydroxytryptamine (serotonin) receptor 2B ) Htr2c ( 5-hydroxytryptamine (serotonin) receptor 2C ) Htr3a ( 5-hydroxytryptamine (serotonin) receptor 3A ) Htr3b ( 5-hydroxytryptamine (serotonin) receptor 3B ) Htr4 ( 5 hydroxytryptamine (serotonin) receptor 4 ) Htr5a ( 5-hydroxytryptamine (serotonin) receptor 5A ) Htr5b ( 5-hydroxytryptamine (serotonin) receptor 5B ) Htr6 ( 5-hydroxytryptamine (serotonin) receptor 6 ) Htr7 ( 5-hydroxytryptamine (serotonin) receptor 7 ) humanNLGN3 ( neuroligin 3 (human) ) HYAL1 ( hyaluronoglucosaminidase 1 ) Icam5 ( intercellular adhesion molecule 5, telencephalin ) Ict1 ( immature colon carcinoma transcript 1 ) Id1 ( inhibitor of DNA binding 1 ) Id2 ( inhibitor of DNA binding 2 ) Id3 ( inhibitor of DNA binding 3 ) Id4 ( inhibitor of DNA binding 4 ) Idh3a ( isocitrate dehydrogenase 3 (NAD+) alpha ) Ier3ip1 ( immediate early response 3 interacting protein 1 ) Ier5 ( immediate early response 5 ) Ifi203 ( interferon activated gene 203 ) Ifi205 ( interferon activated gene 205 ) Ifi44 ( interferon-induced protein 44 ) Ifngr2 ( interferon gamma receptor 2 ) Igf1 ( insulin-like growth factor 1 ) Igf1r ( insulin-like growth factor I receptor ) Igfbp1 ( insulin-like growth factor binding protein 1 ) Igfbp2 ( insulin-like growth factor binding protein 2 ) Igfbp3 ( insulin-like growth factor binding protein 3 ) Igfbp4 ( insulin-like growth factor binding protein 4 ) Igfbp5 ( insulin-like growth factor binding protein 5 ) Igfbp5duplicate ( Insulin-like growth factor binding protein 5 duplicate ) Igfbp6 ( insulin-like growth factor binding protein 6 ) Igfn1 ( immunoglobulin-like and fibronectin type III domain containing 1 ) Igh-6 ( immunoglobulin heavy chain 6 (heavy chain of IgM) ) Igsf9 ( immunoglobulin superfamily, member 9 ) Ikzf4 ( IKAROS family zinc finger 4 ) Il12a ( interleukin 12a ) Il12b ( interleukin 12b ) Il13ra1 ( interleukin 13 receptor, alpha 1 ) Il16 ( interleukin 16 ) Impa1 ( inositol (myo)-1(or 4)-monophosphatase 1 ) Inadl ( InaD-like (Drosophila) ) Incorrect ( Incorrect Lynx1 ) Incorrect2 ( Incorrect Lynx2 ) Inhba ( inhibin beta-A ) Inpp5a ( inositol polyphosphate-5-phosphatase A ) Inpp5j ( inositol polyphosphate 5-phosphatase J ) Insig2 ( insulin induced gene 2 ) Insm2 ( insulinoma-associated 2 ) Iqgap3 ( IQ motif containing GTPase activating protein 3 ) Iqsec3 ( IQ motif and Sec7 domain 3 ) Irs4 ( insulin receptor substrate 4 ) Irx1 ( Iroquois related homeobox 1 (Drosophila) ) Irx2 ( Iroquois related homeobox 2 (Drosophila) ) Irx3 ( Iroquois related homeobox 3 (Drosophila) ) Irx4 ( Iroquois related homeobox 4 (Drosophila) ) Irx5 ( Iroquois related homeobox 5 (Drosophila) ) Isl1 ( ISL1 transcription factor, LIM/homeodomain (islet 1) ) Isl2 ( insulin related protein 2 (islet 2) ) Islr2 ( immunoglobulin superfamily containing leucine-rich repeat 2 ) Itga2b ( integrin alpha 2b ) Itga3 ( integrin alpha 3 ) Itga7 ( integrin alpha 7 ) Itgax ( Integrin alpha X ) Itgb1 ( integrin beta 1 (fibronectin receptor beta) ) Itgb3 ( integrin beta 3 ) Itgb5 ( integrin beta 5 ) Itgb8 ( integrin beta 8 ) Itm2b ( integral membrane protein 2B ) Itpka ( inositol 1,4,5-trisphosphate 3-kinase A ) Itpr1 ( inositol 1,4,5-triphosphate receptor 1 ) Jag1 ( jagged 1 ) Jag2 ( jagged 2 ) Jak2 ( Janus kinase 2 ) Jam3 ( junction adhesion molecule 3 ) Jph3 ( junctophilin 3 ) Jph4 ( junctophilin 4 ) Jup ( junction plakoglobin ) Kalrn ( kalirin, RhoGEF kinase ) Kank4 ( KN motif and ankyrin repeat domains 4 ) Kcna1 ( potassium voltage-gated channel, shaker-related subfamily, member 1 ) Kcna4 ( potassium voltage-gated channel, shaker-related subfamily, member 4 ) Kcnab1 ( potassium voltage-gated channel, shaker-related subfamily, beta member 1 ) Kcnab2 ( potassium voltage-gated channel, shaker-related subfamily, beta member 2 ) Kcnab3 ( potassium voltage-gated channel, shaker-related subfamily, beta member 3 ) Kcnb4-A ( potassium channel beta 4 subunit [Xenopus laevis] ) Kcnc1 ( potassium voltage gated channel, Shaw-related subfamily, member 1 ) Kcnc2 ( potassium voltage gated channel, Shaw-related subfamily, member 2 ) Kcnc3 ( potassium voltage gated channel, Shaw-related subfamily, member 3 ) Kcnc4 ( potassium voltage gated channel, Shaw-related subfamily, member 4 ) Kcnd2 ( potassium voltage-gated channel, Shal-related family, member 2 ) Kcnd3 ( potassium voltage-gated channel, Shal-related family, member 3 ) Kcng3 ( potassium voltage-gated channel, subfamily G, member 3 ) Kcng4 ( potassium voltage-gated channel, subfamily G, member 4 ) Kcnh1 ( potassium voltage-gated channel, subfamily H (eag-related), member 1 ) Kcnh2 ( potassium voltage-gated channel, subfamily H (eag-related), member 2 ) Kcnh4 ( potassium voltage-gated channel, subfamily H (eag-related), member 4 ) Kcnh5 ( potassium voltage-gated channel, subfamily H (eag-related), member 5 ) Kcnh7 ( potassium voltage-gated channel, subfamily H (eag-related), member 7 ) Kcnip1 ( Kv channel-interacting protein 1 ) Kcnip2 ( Kv channel-interacting protein 2 ) Kcnip3 ( Kv channel interacting protein 3, calsenilin ) Kcnip4 ( Kv channel interacting protein 4 ) Kcnj10 ( potassium inwardly-rectifying channel, subfamily J, member 10 ) Kcnj14 ( potassium inwardly-rectifying channel, subfamily J, member 14 ) Kcnj2 ( potassium inwardly-rectifying channel, subfamily J, member 2 ) Kcnj3 ( potassium inwardly-rectifying channel, subfamily J, member 3 ) Kcnj5 ( potassium inwardly-rectifying channel, subfamily J, member 5 ) Kcnj6 ( potassium inwardly-rectifying channel, subfamily J, member 6 ) Kcnk1 ( potassium channel, subfamily K, member 1 ) Kcnk13 ( potassium channel, subfamily K, member 13 ) Kcnk2 ( potassium channel, subfamily K, member 2 ) Kcnma1 ( potassium large conductance calcium-activated channel, subfamily M, alpha member 1 ) Kcnmb4 ( potassium large conductance calcium-activated channel, subfamily M, beta member 4 ) Kcnq2 ( potassium voltage-gated channel, subfamily Q, member 2 ) Kcnq3 ( potassium voltage-gated channel, subfamily Q, member 3 ) Kcnt1 ( potassium channel, subfamily T, member 1 ) Kcnv1 ( potassium channel, subfamily V, member 1 ) Kctd1 ( potassium channel tetramerisation domain containing 1 ) Kctd11 ( potassium channel tetramerisation domain containing 11 ) Kctd12 ( potassium channel tetramerisation domain containing 12 ) Kctd13 ( potassium channel tetramerisation domain containing 13 ) Kctd17 ( potassium channel tetramerisation domain containing 17 ) Kctd4 ( potassium channel tetramerisation domain containing 4 ) Kctd9 ( potassium channel tetramerisation domain containing 9 ) Kdm5b ( lysine (K)-specific demethylase 5B ) Kel ( Kell blood group ) Kera ( keratocan ) Khdrbs1 ( KH domain containing, RNA binding, signal transduction associated 1 ) KIAA0319 ( KIAA0319 ) KIAA1292 ( KIAA1292 ) Kif11 ( kinesin family member 11 ) Kif17 ( kinesin family member 17 ) Kif1b ( kinesin family member 1B ) Kif26a ( kinesin family member 26A ) Kif4 ( kinesin family member 4 ) Kif5a ( kinesin family member 5A ) Kirrel3 ( kin of IRRE like 3 (Drosophila) ) Kiss1r ( KISS1 receptor ) Kit ( kit oncogene ) Kitl ( kit ligand ) Klc3 ( kinesin light chain 3 ) Klf10 ( Kruppel-like factor 10 ) Klf13 ( Kruppel-like factor 13 ) Klf16 ( Kruppel-like factor 16 ) KLHL1 ( kelch-like 1 (Drosophila) ) Klhl23 ( kelch-like 23 ) Klk1b4 ( kallikrein 1-related pepidase b4 ) Klk8 ( kallikrein related-peptidase 8 ) Klra1 ( killer cell lectin-like receptor, subfamily A, member 1 ) Klra3 ( killer cell lectin-like receptor, subfamily A, member 3 ) Kremen1 ( kringle containing transmembrane protein 1 ) Krt12 ( keratin 12 ) Krt18 ( keratin 18 ) Krt19 ( keratin 19 ) Ksr1 ( kinase suppressor of ras 1 ) L1cam ( L1 cell adhesion molecule ) Lamb1 ( laminin B1 ) Lamb3 ( laminin, beta 3 ) Lamc3 ( laminin gamma 3 ) Lamp5 ( lysosomal-associated membrane protein family, member 5 ) Laptm4b ( lysosomal-associated protein transmembrane 4B ) Lats2 ( large tumor suppressor 2 ) Layn ( layilin ) Lbh ( limb-bud and heart ) Lbx2 ( ladybird homeobox homolog 2 (Drosophila) ) Lcp2 ( lymphocyte cytosolic protein 2 ) Ldb1 ( LIM domain binding 1 ) Ldb2 ( LIM domain binding 2 ) Lect1 ( leukocyte cell derived chemotaxin 1 ) Lef1 ( lymphoid enhancer binding factor 1 ) Leng8 ( leukocyte receptor cluster (LRC) member 8 ) Lepr ( leptin receptor ) Lfng ( LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase ) Lgals1 ( lectin, galactose binding, soluble 1 ) Lgals3 ( lectin, galactose binding, soluble 3 ) Lgals9 ( lectin, galactose binding, soluble 9 ) Lgi1 ( leucine-rich repeat LGI family, member 1 ) Lgi2 ( leucine-rich repeat LGI family, member 2 ) Lgi3 ( leucine-rich repeat LGI family, member 3 ) Lgi4 ( leucine-rich repeat LGI family, member ) Lhfp ( lipoma HMGIC fusion partner ) Lhx1 ( LIM homeobox protein 1 ) Lhx2 ( LIM homeobox protein 2 ) Lhx3 ( LIM homeobox protein 3 ) Lhx4 ( LIM homeobox protein 4 ) Lhx5 ( LIM homeobox protein 5 ) Lhx6 ( LIM homeobox protein 6 ) Lhx8 ( LIM homeobox protein 8 ) Lhx9 ( LIM homeobox protein 9 ) Lifr ( Leukemia inhibitory factor receptor ) Lilrb3 ( leukocyte immunoglobulin-like receptor, subfamily B ) Lima1 ( LIM domain and actin binding 1 ) Limch1 ( LIM and calponin homology domains 1 ) Limd2 ( LIM domain containing 2 ) Limk1 ( LIM-domain containing, protein kinase ) Limk2 ( LIM motif-containing protein kinase 2 ) Lix1 ( limb expression 1 homolog (chicken) ) Lmna ( lamin A ) Lmo1 ( LIM domain only 1 ) Lmo2 ( LIM domain only 2 ) Lmo3 ( LIM domain only 3 ) Lmo4 ( LIM domain only 4 ) Lmx1a ( LIM homeobox transcription factor 1 alpha ) Lmx1b ( LIM homeobox transcription factor 1 beta ) LOC233220 ( similar to MrgA6 G protein-coupled receptor ) LOC236844 ( similar to RIKEN cDNA 3110001N18 ) LOC240233 ( similar to KIAA1317 protein ) LOC329150 ( similar to axonemal dynein heavy chain 7 ) LOC383757 ( similar to Transcriptional repressor scratch 2 (Scratch homolog 2 zinc finger protein) ) LOC433228 ( hypothetical gene supported by AK082257 ) LOC547214 ( similar to G protein coupled receptor ) LOC553091 ( hypothetical LOC553091 ) LOC553901 ( hypothetical LOC553901 ) LOC675706 ( similar to melanoma antigen ) Lpar1 ( lysophosphatidic acid receptor 1 ) Lphn1 ( latrophilin 1 ) Lpl ( lipoprotein lipase ) Lrba ( LPS-responsive beige-like anchor ) Lrfn2 ( leucine rich repeat and fibronectin type III domain containing 2 ) Lrfn5 ( leucine rich repeat and fibronectin type III domain containing 5 ) Lrig1 ( leucine-rich repeats and immunoglobulin-like domains 1 ) Lrig2 ( leucine-rich repeats and immunoglobulin-like domains 2 ) Lrp10 ( low-density lipoprotein receptor-related protein 10 ) Lrp12 ( low density lipoprotein-related protein 12 ) Lrp2 ( low density lipoprotein receptor-related protein 2 ) Lrp3 ( low density lipoprotein receptor-related protein 3 ) Lrp8 ( low density lipoprotein receptor-related protein 8, apolipoprotein e receptor ) Lrpap1 ( low density lipoprotein receptor-related protein associated protein 1 ) Lrrc16a ( leucine rich repeat containing 16A ) Lrrc4 ( leucine rich repeat containing 4 ) Lrrc47 ( RIKEN cDNA 2900010D03 gene ) Lrrc55 ( leucine rich repeat containing 55 ) Lrrc8c ( leucine rich repeat containing 8 family, member C ) Lrrk2 ( leucine-rich repeat kinase 2 ) Lrrn1 ( leucine rich repeat protein 1, neuronal ) Lrrn2 ( leucine rich repeat protein 2, neuronal ) Lrrn3 ( leucine rich repeat protein 3, neuronal ) Lrrtm1 ( leucine rich repeat transmembrane neuronal 1 ) Lrrtm2 ( leucine rich repeat transmembrane neuronal 2 ) Lrrtm3 ( leucine rich repeat transmembrane neuronal 3 ) Lsamp ( limbic system-associated membrane protein ) Lss ( lanosterol synthase ) Lxn ( latexin ) Ly6e ( lymphocyte antigen 6 complex, locus E ) Ly6h ( lymphocyte antigen 6 complex, locus H ) Ly6k ( lymphocyte antigen 6 complex, locus K ) Lynx1 ( Ly6/neurotoxin 1 ) Lypd1 ( Ly6/Plaur domain containing 1 ) Lypd2 ( Ly6/Plaur domain containing 2 ) Lypd6 ( LY6/PLAUR domain containing 6 ) Lzts1 ( leucine zipper, putative tumor suppressor 1 ) Mafa ( v-maf musculoaponeurotic fibrosarcoma oncogene family, protein A (avian) ) Mafb ( v-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian) ) Mag ( myelin-associated glycoprotein ) MAGEA8 ( melanoma antigen family A, 8 ) Maged1 ( melanoma antigen, family D, 1 ) Magel2 ( melanoma antigen, family L, 2 ) Man1a ( mannosidase 1, alpha ) Man1a2 ( mannosidase, alpha, class 1A, member 2 ) Maoa ( monoamine oxidase A ) Maob ( monoamine oxidase B ) Map1b ( microtubule-associated protein 1B ) Map1lc3a ( microtubule-associated protein 1 light chain 3 alpha ) Map2k6 ( mitogen-activated protein kinase kinase 6 ) Map4k5 ( mitogen-activated protein kinase kinase kinase kinase 5 ) Mapk1 ( mitogen-activated protein kinase 1 ) Mapk3 ( mitogen activated protein kinase 3 ) Mapk4 ( mitogen-activated protein kinase 4 ) Mapk8 ( mitogen-activated protein kinase 8 ) Mapk9 ( mitogen activated protein kinase 9 ) Mapt ( microtubule-associated protein tau ) March1 ( membrane-associated ring finger (C3HC4) 1 ) March4 ( membrane-associated ring finger (C3HC4) 4 ) Marcksl1 ( MARCKS-like 1 ) Mas1 ( MAS1 oncogene ) Matk ( megakaryocyte-associated tyrosine kinase ) Mb21d2 ( Mab-21 domain containing 2 ) Mbc2 ( membrane bound C2 domain containing protein ) Mbd2 ( methyl-CpG binding domain protein 2 ) Mbd3 ( methyl-CpG binding domain protein 3 ) Mbd4 ( methyl-CpG binding domain protein 4 ) Mbd5 ( methyl-CpG binding domain protein 5 ) Mbp ( myelin basic protein ) Mc3r ( melanocortin 3 receptor ) Mc4r ( melanocortin 4 receptor ) Mcm2 ( minichromosome maintenance deficient 2 mitotin (S. cerevisiae) ) Mcm5 ( minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) ) Mcm7 ( minichromosome maintenance deficient 7 (S. cerevisiae) ) Mdga1 ( MAM domain containing glycosylphosphatidylinositol anchor 1 ) Mdh1 ( malate dehydrogenase 1, NAD (soluble) ) Mdk ( midkine ) Me2 ( malic enzyme 2, NAD(+)-dependent, mitochondrial ) Mecom ( MDS1 and EVI1 complex locus ) Mecp2 ( methyl CpG binding protein 2 ) Med12 ( mediator of RNA polymerase II transcription, subunit 12 homolog (yeast) ) Med4 ( mediator of RNA polymerase II transcription, subunit 4 homolog (yeast) ) Mef2c ( myocyte enhancer factor 2C ) Meis1 ( Meis homeobox 1 ) Meis2 ( Meis homeobox 2 ) Melk ( maternal embryonic leucine zipper kinase ) Meox2 ( mesenchyme homeobox 2 ) Met ( met proto-oncogene ) Mfap2 ( microfibrillar-associated protein 2 ) Mfap4 ( microfibrillar-associated protein 4 ) Mfn1 ( mitofusin 1 ) Mfn2 ( mitofusin 2 ) Mfng ( manic fringe homolog (Drosophila) ) Mgat5 ( mannoside acetylglucosaminyltransferase 5 ) Mgll ( monoglyceride lipase ) Mglur2 ( Rat Metabotropic Glutamate Recep ) Mgst3 ( microsomal glutathione S-transferase 3 ) Mid1 ( midline 1 ) Mif ( macrophage migration inhibitory factor ) Mir24-1 ( Mir24-1 microRNA 24-1 ) Mirn34a ( microRNA 34a ) Mjd ( Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3) homolog (human) ) Mki67 ( antigen identified by monoclonal antibody Ki 67 ) Mllt11 ( myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 ) Mmp15 ( matrix metalloproteinase 15 ) Mmp17 ( matrix metallopeptidase 17 ) Mmp2 ( matrix metallopeptidase 2 ) Mmp9 ( matrix metallopeptidase 9 ) Mnx1 ( motor neuron and pancreas homeobox 1 ) Mobp ( myelin-associated oligodendrocytic basic protein ) Moxd1 ( monooxygenase, DBH-like 1 ) Mpc1 ( mitochondrial pyruvate carrier 1 ) Mpc2 ( mitochondrial pyruvate carrier 2 ) Mpdz ( multiple PDZ domain protein ) Mpp3 ( membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) ) Mpp3 ( membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) ) Mpped1 ( metallophosphoesterase domain containing 1 ) Mrps21 ( mitochondrial ribosomal protein S21 ) Msi2 ( Musashi homolog 2 (Drosophila) ) Msrb2 ( methionine sulfoxide reductase B2 ) Mst1r ( macrophage stimulating 1 receptor (c-met-related tyrosine kinase) ) Msx1 ( homeobox, msh-like 1 ) Mt1 ( metallothionein 1 ) Mtap ( methylthioadenosine phosphorylase ) Mtap2 ( microtubule-associated protein 2 ) Mtap4 ( microtubule-associated protein 4 ) Mtif2 ( mitochondrial translational initiation factor 2 ) Mtnr1a ( melatonin receptor 1A ) Mtss1 ( metastasis suppressor 1 ) Mup2 ( major urinary protein 2 ) Mxi1 ( Max interacting protein 1 ) Mxi1SR ( Max interacting protein 1-SR ) Myc ( myelocytomatosis oncogene ) Mycbp ( c-myc binding protein ) Mycl1 ( lung carcinoma myc related oncogene 1 ) Mycn ( v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) ) Myl6 ( myosin, light polypeptide 6, alkali, smooth muscle and non-muscle ) Myo1b ( myosin IB ) Myt1l ( myelin transcription factor 1-like ) N28178 ( expressed sequence N28178 ) Naca ( nascent polypeptide-associated complex alpha polypeptide ) Nae1 ( NEDD8 activating enzyme E1 subunit 1 ) Napb ( N-ethylmaleimide sensitive fusion protein attachment protein beta ) Nars ( asparaginyl-tRNA synthetase ) Nbl1 ( neuroblastoma, suppression of tumorigenicity 1 ) Ncald ( neurocalcin delta ) Nck2 ( non-catalytic region of tyrosine kinase adaptor protein 2 ) Nckap1 ( NCK-associated protein 1 ) Ncoa1 ( nuclear receptor coactivator 1 ) Ncoa7 ( nuclear receptor coactivator 7 ) Ncor1 ( nuclear receptor co-repressor 1 ) Ndc80 ( NDC80 homolog, kinetochore complex component (S. cerevisiae) ) Ndel1 ( nuclear distribution gene E-like homolog 1 (A. nidulans) ) Ndn ( necdin ) Ndnf ( neuron-derived neurotrophic factor ) Ndrg1 ( N-myc downstream regulated gene 1 ) Ndrg3 ( N-myc downstream regulated gene 3 ) Ndrg4 ( N-myc downstream regulated gene 4 ) Ndst3 ( N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 ) Ndst4 ( N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4 ) Ndufal3 ( genes associated with retinoid-IFN-induced mortality 19 ) Ndufv1 ( NADH dehydrogenase (ubiquinone) flavoprotein 1 ) Ndufv2 ( NADH dehydrogenase (ubiquinone) flavoprotein 2 ) Necab1 ( N-terminal EF-hand calcium binding protein 1 ) Nedd4l ( neural precursor cell expressed, developmentally down-regulated gene 4-like ) Nefh ( neurofilament, heavy polypeptide ) Nefl ( neurofilament, light polypeptide ) Nefm ( neurofilament, medium polypeptide ) Negr1 ( neuronal growth regulator 1 ) Nek7 ( NIMA (never in mitosis gene a)-related expressed kinase 7 ) Nell2 ( NEL-like 2 (chicken) ) Neo1 ( neogenin ) Nes ( nestin ) Neto1 ( neuropilin (NRP) and tolloid (TLL)-like 1 ) Neto2 ( neuropilin (NRP) and tolloid (TLL)-like 2 ) Neurod1 ( neurogenic differentiation 1 ) Neurod2 ( neurogenic differentiation 2 ) Neurod4 ( neurogenic differentiation 4 ) Neurod6 ( neurogenic differentiation 6 ) Neurog1 ( neurogenin 1 ) Neurog2 ( neurogenin 2 ) Neurog3 ( neurogenin 3 ) Nf1 ( neurofibromatosis 1 ) Nf2 ( neurofibromatosis 2 ) Nfia ( nuclear factor I/A ) Nfib ( nuclear factor I/B ) Nfil3 ( nuclear factor, interleukin 3, regulated ) Nfix ( nuclear factor I/X ) Ngef ( neuronal guanine nucleotide exchange factor ) Ngf ( nerve growth factor ) Ngfr ( nerve growth factor receptor (TNFR superfamily, member 16) ) Nhlh1 ( nescient helix loop helix 1 ) Nhp2 ( NHP2 ribonucleoprotein ) Nhsl1 ( NHS-like 1 ) Nisch ( nischarin ) NKAIN2 ( Na+/K+ transporting ATPase interacting 2 ) Nkain3 ( Na+/K+ transporting ATPase interacting 3 ) Nkain4 ( Na+/K+ transporting ATPase interacting 4 ) Nkd1 ( naked cuticle 1 homolog (Drosophila) ) Nkx2-1 ( NK2 homeobox 1 ) Nkx2-2 ( NK2 transcription factor related, locus 2 (Drosophila) ) Nlgn1 ( neuroligin 1 ) Nlgn2 ( neuroligin 2 ) Nlgn3 ( neuroligin 3 ) Nlgn4 ( neuroligin 4 ) Nmb ( neuromedin B ) Nmbr ( neuromedin B receptor ) Nms ( neuromedin S ) Nmu ( neuromedin U ) Nnat ( neuronatin ) Nog ( noggin ) Nomo1 ( nodal modulator 1 ) Nope ( neighbor of Punc E11 ) Nos1 ( nitric oxide synthase 1, neuronal ) NOshortname1 ( chromosome 6 clone RP24-69C19 ) NOshortname2 ( transcribed sequence with weak similarity to protein ref:NP_061720.1 (H.sapiens) axonemal dynein heavy chain 7 [Homo sapiens] ) Notch1 ( notch 1 ) Notch2 ( notch 2 ) Notch3 ( notch 3 ) Nov ( nephroblastoma overexpressed gene ) Nova1 ( neuro-oncological ventral antigen 1 ) Npas1 ( neuronal PAS domain protein 1 ) Npas2 ( neuronal PAS domain protein 2 ) Npas3 ( neuronal PAS domain protein 3 ) Npb ( neuropeptide B ) Npbwr1 ( neuropeptides B/W receptor 1 ) Npc1 ( Niemann Pick type C1 ) Npc1l1 ( NPC1-like 1 ) Npc2 ( Niemann Pick type C2 ) Npnt ( nephronectin ) Npr1 ( natriuretic peptide receptor 1 ) Npr3 ( natriuretic peptide receptor 3 ) Npsr1 ( neuropeptide S receptor 1 ) Nptx1 ( neuronal pentraxin 1 ) Nptx2 ( neuronal pentraxin 2 ) Npvf ( neuropeptide VF precursor ) Npy ( neuropeptide Y ) Npy1r ( neuropeptide Y receptor Y1 ) Npy2r ( neuropeptide Y receptor Y2 ) Npy5r ( neuropeptide Y receptor Y5 ) Nr0b1 ( nuclear receptor subfamily 0, group B, member 1 ) Nr1d1 ( nuclear receptor subfamily 1, group D, member 1 ) Nr2c2 ( nuclear receptor subfamily 2, group C, member 2 ) Nr2e1 ( nuclear receptor subfamily 2, group E, member 1 ) Nr2f1 ( nuclear receptor subfamily 2, group F, member 1 ) Nr2f2 ( nuclear receptor subfamily 2, group F, member 2 ) Nr3c1 ( nuclear receptor subfamily 3, group C, member 1 ) Nr3c2 ( nuclear receptor subfamily 3, group C, member 2 ) Nr4a1 ( nuclear receptor subfamily 4, group A, member 1 ) Nr4a2 ( nuclear receptor subfamily 4, group A, member 2 ) Nr4a3 ( nuclear receptor subfamily 4, group A, member 3 ) Nr5a1 ( nuclear receptor subfamily 5, group A, member 1 ) Nrep ( neuronal regeneration related protein ) Nrg1 ( neuregulin 1 ) Nrgn ( neurogranin ) Nrip1 ( nuclear receptor interacting protein 1 ) Nrip3 ( nuclear receptor interacting protein 3 ) Nrn1 ( neuritin 1 ) Nrp1 ( neuropilin 1 ) Nrp2 ( neuropilin 2 ) Nrtn ( neurturin ) Nrxn1 ( neurexin I ) Nrxn2 ( neurexin II ) Nsdhl ( NAD(P) dependent steroid dehydrogenase-like ) Nsf ( N-ethylmaleimide sensitive fusion protein ) Nsg1 ( neuron specific gene family member 1 ) Nsmf ( NMDA receptor synaptonuclear signaling and neuronal migration factor ) Ntf3 ( neurotrophin 3 ) Ntf5 ( neurotrophin 5 ) Ntn1 ( netrin 1 ) Ntng1 ( netrin G1 ) Ntng2 ( netrin G2 ) Ntrk1 ( neurotrophic tyrosine kinase, receptor, type 1 ) Ntrk2 ( neurotrophic tyrosine kinase, receptor, type 2 ) Ntrk3 ( neurotrophic tyrosine kinase, receptor, type 3 ) Nts ( neurotensin ) Ntsr1 ( neurotensin receptor 1 ) Ntsr2 ( neurotensin receptor 2 ) Nucb2 ( nucleobindin 2 ) Nudt2 ( nudix (nucleoside diphosphate linked moiety X)-type motif 2 ) Numb ( numb gene homolog (Drosophila) ) Numbl ( numb-like ) Nxph4 ( neurexophilin 4 ) Oasl2 ( 2-5 oligoadenylate synthetase-like 2 ) Odc1 ( ornithine decarboxylase, structural 1 ) Odz3 ( odd Oz/ten-m homolog 3 (Drosophila) ) Ogfr ( opioid growth factor receptor ) Olfm1 ( olfactomedin 1 ) Olfml2b ( olfactomedin-like 2B ) Olfr732 ( olfactory receptor 732 ) Olfr734 ( olfactory receptor 734 ) Olig1 ( oligodendrocyte transcription factor 1 ) Olig2 ( oligodendrocyte transcription factor 2 ) Olig3 ( oligodendrocyte transcription factor 3 ) Oma1 ( OMA1 homolog, zinc metallopeptidase (S. cerevisiae) ) Ophn1 ( oligophrenin 1 ) Opn3 ( opsin 3 ) Opn4 ( opsin 4 (melanopsin) ) Oprd1 ( opioid receptor, delta 1 ) Oprk1 ( opioid receptor, kappa 1 ) Oprm1 ( opioid receptor, mu 1 ) Osbpl1a ( oxysterol binding protein-like 1A ) Otof ( otoferlin ) Otp ( orthopedia homolog (Drosophila) ) Otx1 ( orthodenticle homolog 1 (Drosophila) ) Otx2 ( orthodenticle homolog 2 (Drosophila) ) Oxt ( oxytocin ) Oxtr ( oxytocin receptor ) P287 ( Protein 287 ) P297 ( Protein 297 ) P2rx7 ( purinergic receptor P2X, ligand-gated ion channel, 7 ) P2ry1 ( purinergic receptor P2Y, G-protein coupled 1 ) P2ry12 ( purinergic receptor P2Y, G-protein coupled 12 ) P468 ( Protein 468 ) Pacsin3 ( protein kinase C and casein kinase substrate in neurons 3 ) Pafah1b1 ( platelet-activating factor acetylhydrolase, isoform 1b, subunit 1 ) Pak1 ( p21 protein (Cdc42/Rac)-activated kinase 1 ) Pak6 ( p21 protein (Cdc42/Rac)-activated kinase 6 ) Pam ( peptidylglycine alpha-amidating monooxygenase ) Panx2 ( pannexin 2 ) Pard6a ( par-6 (partitioning defective 6,) homolog alpha (C. elegans) ) Park2 ( parkin ) Park7 ( Parkinson disease (autosomal recessive, early onset) 7 ) Pax2 ( paired box gene 2 ) Pax3 ( paired box gene 3 ) Pax6 ( paired box gene 6 ) Pax7 ( paired box gene 7 ) Pbk ( PDZ binding kinase ) Pbx1 ( pre B-cell leukemia transcription factor 1 ) Pbx3 ( pre B-cell leukemia transcription factor 3 ) Pcbd1 ( pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 ) Pcbp3 ( poly(rC) binding protein 3 ) Pcdh17 ( protocadherin 17 ) Pcdh20 ( protocadherin 20 ) Pcdh9 ( protocadherin 9 ) Pcdha1 ( protocadherin alpha 1 ) Pcdha10 ( protocadherin alpha 10 ) Pcdha11 ( protocadherin alpha 11 ) Pcdha13 ( protocadherin alpha 13 ) Pcdha4 ( protocadherin alpha 4 ) Pcdha6 ( protocadherin alpha 6 ) Pcdha7 ( protocadherin alpha 7 ) Pcdha9 ( protocadherin alpha 9 ) Pcdhgb1 ( protocadherin gamma subfamily B, 1 ) Pcnt ( pericentrin (kendrin) ) Pcp2 ( Purkinje cell protein 2 (L7) ) Pcp4 ( Purkinje cell protein 4 ) Pcp4l1 ( Purkinje cell protein 4-like 1 ) pcsk1 ( proprotein convertase subtilisin/kexin type 1 ) Pcsk5 ( proprotein convertase subtilisin/kexin type 5 ) Pcsk9 ( proprotein convertase subtilisin/kexin type 9 ) Pde10a ( phosphodiesterase 10A ) Pde1a ( phosphodiesterase 1A, calmodulin-dependent ) Pde1b ( phosphodiesterase 1B, Ca2+-calmodulin dependent ) Pde1c ( phosphodiesterase 1C ) Pde3b ( phosphodiesterase 3B, cGMP-inhibited ) Pde4a ( phosphodiesterase 4A, cAMP specific ) Pde4b ( phosphodiesterase 4B, cAMP specific ) Pde4d ( phosphodiesterase 4D, cAMP specific ) Pde7b ( phosphodiesterase 7B ) Pde8b ( phosphodiesterase 8B ) Pde9a ( phosphodiesterase 9A ) Pdgfra ( platelet derived growth factor receptor, alpha polypeptide ) Pdgfrb ( platelet derived growth factor receptor, beta polypeptide ) Pdp1 ( pyruvate dehyrogenase phosphatase catalytic subunit 1 ) Pdyn ( prodynorphin ) Pdzk1ip1 ( PDZK1 interacting protein 1 ) Pdzrn3 ( PDZ domain containing RING finger 3 ) Pecam1 ( platelet/endothelial cell adhesion molecule 1 ) Peg10 ( paternally expressed 10 ) Peg3 ( paternally expressed 3 ) Penk ( preproenkephalin ) Per1 ( period homolog 1 (Drosophila) ) Per2 ( period circadian clock 2 ) Pex5l ( peroxisomal biogenesis factor 5-like ) Pfkp ( phosphofructokinase, platelet ) Pgr ( progesterone receptor ) Pgrmc1 ( progesterone receptor membrane component 1 ) Phactr1 ( phosphatase and actin regulator 1 ) Phactr4 ( phosphatase and actin regulator 4 ) Phb ( prohibitin ) Phf6 ( PHD finger protein 6 ) Phip ( pleckstrin homology domain interacting protein ) Phox2a ( paired-like homeobox 2a ) Phox2b ( paired-like homeobox 2b ) PI31 ( proteasome inhibitor hPI31 ) Pias3 ( protein inhibitor of activated STAT 3 ) Pik3r1 ( phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha) ) Pip5k1a ( phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha ) Pirt ( phosphoinositide-interacting regulator of transient receptor potential channels ) Pisd ( phosphatidylserine decarboxylase ) Pitpnc1 ( RIKEN cDNA 1110020B03 gene ) Pitpnm2 ( phosphatidylinositol transfer protein, membrane-associated 2 ) Pitx1 ( paired-like homeodomain transcription factor 1 ) Pitx2 ( paired-like homeodomain transcription factor 2 ) Pitx3 ( paired-like homeodomain transcription factor 3 ) Pkd1 ( polycystic kidney disease 1 homolog ) Pkd2 ( polycystic kidney disease 2 ) Pkp4 ( plakophilin 4 ) Pla2g7 ( phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) ) Plagl1 ( pleiomorphic adenoma gene-like 1 ) Plcb1 ( phospholipase C, beta 1 ) Plcxd2 ( phosphatidylinositol-specific phospholipase C, X domain containing 2 ) Pld3 ( phospholipase D family, member 3 ) Plekha2 ( pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 ) Plekhb1 ( pleckstrin homology domain containing, family B (evectins) member 1 ) Plekhg1 ( pleckstrin homology domain containing, family G (with RhoGef domain) member 1 ) Plk2 ( polo-like kinase 2 ) Plk3 ( polo-like kinase 3 ) Plp1 ( proteolipid protein (myelin) 1 ) Plxdc1 ( plexin domain containing 1 ) Plxdc2 ( plexin domain containing 2 ) Plxna1 ( plexin A1 ) plxna2 ( plexin A2 ) Plxna3 ( plexin A3 ) Plxna4 ( plexin A4 ) Plxnb2 ( plexin B2 ) Plxnc1 ( plexin C1 ) Plxnd1 ( plexin D1 ) Pmch ( pro-melanin-concentrating hormone ) Pmp22 ( peripheral myelin protein 22 ) Pnck ( Pregnanc y upregulated non-ubiquitously expressed CaM kinase ) Pnkd ( paroxysmal nonkinesiogenic dyskinesia ) Pnma2 ( Paraneoplastic antigen MA2 ) Pnmt ( phenylethanolamine-N-methyltransferase ) Pnoc ( prepronociceptin ) Pnpla6 ( patatin-like phospholipase domain containing 6 ) Podxl2 ( podocalyxin-like 2 ) Pogz ( pogo transposable element with ZNF domain ) Polr1d ( polymerase (RNA) I polypeptide D ) Polr2a ( polymerase (RNA) II (DNA directed) polypeptide A ) Polr3e ( polymerase (RNA) III (DNA directed) polypeptide E ) Polr3k ( polymerase (RNA) III (DNA directed) polypeptide K ) Pomc ( pro-opiomelanocortin-alpha ) PomcDoNotUse ( Proopiomelanocortin ) Pou2f1 ( POU domain, class 2, transcription factor 1 ) Pou3f1 ( POU domain, class 3, transcription factor 1 ) Pou3f2 ( POU domain, class 3, transcription factor 2 ) Pou3f3 ( POU domain, class 3, transcription factor 3 ) Pou3f4 ( POU domain, class 3, transcription factor 4 ) Pou4f1 ( POU domain, class 4, transcription factor 1 ) Pou5f1 ( POU domain, class 5, transcription factor 1 ) Pou6f1 ( POU domain, class 6, transcription factor 1 ) Ppargc1a ( peroxisome proliferative activated receptor, gamma, coactivator 1 alpha ) Ppargc1b ( peroxisome proliferative activated receptor, gamma, coactivator 1 beta ) Ppfia1 ( protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1 ) Ppfia4 ( protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4 ) Ppfibp1 ( PTPRF interacting protein, binding protein 1 (liprin beta 1) ) Ppm1a ( protein phosphatase 1A, magnesium dependent, alpha isoform ) Ppm1e ( protein phosphatase 1E (PP2C domain containing) ) Ppm1j ( protein phosphatase 1J ) Ppp1ca ( protein phosphatase 1, catalytic subunit, alpha isoform ) Ppp1cc ( protein phosphatase 1, catalytic subunit, gamma isoform ) Ppp1r14c ( protein phosphatase 1, regulatory (inhibitor) subunit 14c ) Ppp1r16b ( protein phosphatase 1, regulatory (inhibitor) subunit 16B ) Ppp1r17 ( protein phosphatase 1, regulatory subunit 17 ) Ppp1r1a ( protein phosphatase 1, regulatory (inhibitor) subunit 1A ) Ppp1r1b ( protein phosphatase 1, regulatory (inhibitor) subunit 1B ) Ppp1r1c ( protein phosphatase 1, regulatory (inhibitor) subunit 1C ) Ppp1r2 ( protein phosphatase 1, regulatory (inhibitor) subunit 2 ) Ppp1r7 ( protein phosphatase 1, regulatory (inhibitor) subunit 7 ) Ppp1r9a ( protein phosphatase 1, regulatory (inhibitor) subunit 9A ) Ppp2r2a ( protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform ) Ppp2r2b ( protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform ) Ppp2r2c ( protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform ) Ppp2r2d ( protein phosphatase 2, regulatory subunit B, delta isoform ) Ppp2r5b ( protein phosphatase 2, regulatory subunit B (B56), beta isoform ) Ppp2r5c ( protein phosphatase 2, regulatory subunit B (B56), gamma isoform ) Ppp3ca ( protein phosphatase 3, catalytic subunit, alpha isoform ) Ppp4c ( protein phosphatase 4, catalytic subunit ) Ppp5c ( protein phosphatase 5, catalytic subunit ) Ppp6c ( protein phosphatase 6, catalytic subunit ) Prdx1 ( peroxiredoxin 1 ) Prickle1 ( prickle homolog 1 (Drosophila) ) Prkacb ( protein kinase, cAMP dependent, catalytic, beta ) Prkca ( protein kinase C, alpha ) Prkcb ( protein kinase C, beta ) Prkcb1 ( protein kinase C, beta 1 ) Prkcc ( protein kinase C, gamma ) Prkcd ( protein kinase C, delta ) Prkch ( protein kinase C, eta ) Prkcq ( protein kinase C, theta ) Prmt2 ( protein arginine N-methyltransferase 2 ) Prmt8 ( protein arginine N-methyltransferase 8 ) Prnp ( prion protein ) Prodh ( proline dehydrogenase ) Prok2 ( prokineticin 2 ) Prokr2 ( prokineticin receptor 2 ) Prom1 ( prominin 1 ) Prosapip1 ( ProSAPiP1 protein ) Prox1 ( prospero-related homeobox 1 ) Prph ( peripherin ) Prrx1 ( paired related homeobox 1 ) Prss12 ( protease, serine, 12 neurotrypsin (motopsin) ) Prtg ( protogenin homolog (Gallus gallus) ) Prune ( prune homolog (Drosophila) ) Psen1 ( presenilin 1 ) Psen2 ( presenilin 2 ) Psp ( parotid secretory protein ) Pspn ( persephin ) Ptbp2 ( polypyrimidine tract binding protein 2 ) Ptch1 ( patched homolog 1 ) Ptch2 ( patched homolog 2 ) Ptchd1 ( patched domain containing 1 ) Pten ( phosphatase and tensin homolog ) Ptf1a ( pancreas specific transcription factor, 1a ) Ptgds ( prostaglandin D2 synthase (brain) ) Ptger2 ( prostaglandin E receptor 2 (subtype EP2) ) Pthlh ( Parathyroid hormone-like peptide ) Ptk2 ( PTK2 protein tyrosine kinase 2 ) Ptk2b ( PTK2 protein tyrosine kinase 2 beta ) Ptn ( pleiotrophin ) Ptpn2 ( protein tyrosine phosphatase, non-receptor type 2 ) Ptpn3 ( protein tyrosine phosphatase, non-receptor type 3 ) Ptpn5 ( protein tyrosine phosphatase, non-receptor type 5 ) Ptprc ( protein tyrosine phosphatase, receptor type, C ) Ptprd ( protein tyrosine phosphatase, receptor type, D ) Ptprf ( protein tyrosine phosphatase, receptor type, F ) Ptprk ( protein tyrosine phosphatase, receptor type, K ) Ptpro ( protein tyrosine phosphatase, receptor type, O ) Ptpru ( protein tyrosine phosphatase, receptor type, U ) Ptprz1 ( protein tyrosine phosphatase, receptor type Z, polypeptide 1 ) Pttg1 ( pituitary tumor-transforming gene 1 ) Ptx3 ( pentraxin related gene ) Punc ( putative neuronal cell adhesion molecule ) Pus10 ( pseudouridylate synthase 10 ) Pvalb ( parvalbumin ) Pvrl1 ( poliovirus receptor-related 1 ) Pvrl3 ( poliovirus receptor-related 3 ) Pygb ( brain glycogen phosphorylase ) Pyy ( peptide YY ) Rab37 ( RAB37, member of RAS oncogene family ) Rab39b ( RAB39B, member RAS oncogene family ) Rab3b ( RAB3B, member RAS oncogene family ) Rab5b ( RAB5B, member RAS oncogene family ) Rac1 ( RAS-related C3 botulinum substrate 1 ) Rac3 ( RAS-related C3 botulinum substrate 3 ) Ramp3 ( receptor (calcitonin) activity modifying protein 3 ) Ranbp1 ( RAN binding protein 1 ) Rap1a ( RAS-related protein-1a ) Rap1gds1 ( RAP1, GTP-GDP dissociation stimulator 1 ) Rap2a ( RAS related protein 2a ) Rapgef3 ( Rap guanine nucleotide exchange factor (GEF) 3 ) Rapgef4 ( Rap guanine nucleotide exchange factor (GEF) 4 ) Rapgef5 ( Rap guanine nucleotide exchange factor (GEF) 5 ) Rapsn ( receptor-associated protein of the synapse ) Rarb ( retinoic acid receptor, beta ) Rasa3 ( RAS p21 protein activator 3 ) Rasal1 ( RAS protein activator like 1 (GAP1 like) ) Rasd2 ( RASD family, member 2 ) Rasgef1b ( RasGEF domain family, member 1B ) Rasgrf1 ( RAS protein-specific guanine nucleotide-releasing factor 1 ) Rasgrf2 ( RAS protein-specific guanine nucleotide-releasing factor 2 ) Rasgrp1 ( RAS guanyl releasing protein 1 ) Rasgrp2 ( RAS, guanyl releasing protein 2 ) Rasl11b ( RAS-like, family 11, member B ) Rax ( retina and anterior neural fold homeobox ) Rbms1 ( RNA binding motif, single stranded interacting protein 1 ) Rbp1 ( retinol binding protein 1, cellular ) Rbp4 ( retinol binding protein 4, plasma ) Rcan2 ( regulator of calcineurin 2 ) Rcn1 ( reticulocalbin 1 ) Ref ( Reference Set ) Rel ( reticuloendotheliosis oncogene ) Rell1 ( RELT-like 1 ) Reln ( reelin ) Rerg ( RAS-like, estrogen-regulated, growth-inhibitor ) Resp18 ( regulated endocrine-specific protein 18 ) Rest ( RE1-silencing transcription factor ) Rfng ( RFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase ) Rfx3 ( regulatory factor X, 3 (influences HLA class II expression) ) Rfxank ( regulatory factor X-associated ankyrin-containing protein ) Rgl1 ( ral guanine nucleotide dissociation stimulator,-like 1 ) Rgs10 ( regulator of G-protein signalling 10 ) Rgs11 ( regulator of G-protein signaling 11 ) Rgs12 ( regulator of G-protein signaling 12 ) Rgs14 ( regulator of G-protein signaling 14 ) Rgs16 ( regulator of G-protein signaling 16 ) Rgs17 ( regulator of G-protein signaling 17 ) Rgs2 ( regulator of G-protein signaling 2 ) Rgs20 ( regulator of G-protein signaling 20 ) Rgs3 ( regulator of G-protein signaling 3 ) Rgs4 ( regulator of G-protein signaling 4 ) Rgs5 ( regulator of G-protein signaling 5 ) Rgs7 ( regulator of G protein signaling 7 ) Rgs8 ( regulator of G-protein signaling 8 ) Rgs9 ( regulator of G-protein signaling 9 ) Rhbdl3 ( rhomboid, veinlet-like 3 (Drosophila) ) Rhoa ( ras homolog gene family, member A ) Rhob ( ras homolog gene family, member B ) Rhou ( ras homolog gene family, member U ) Rhov ( ras homolog gene family, member V ) Rhox8 ( reproductive homeobox 8 ) Rif1 ( Rap1 interacting factor 1 homolog (yeast) ) Rlbp1 ( retinaldehyde binding protein 1 ) Rnd1 ( Rho family GTPase 1 ) Rnd2 ( Rho family GTPase 2 ) Rnd3 ( Rho family GTPase 3 ) Robo1 ( roundabout homolog 1 (Drosophila) ) Robo2 ( roundabout homolog 2 (Drosophila) ) Rora ( RAR-related orphan receptor alpha ) Rorb ( RAR-related orphan receptor beta ) RP23-181C16 ( chromosome 3 clone RP23-181C16 ) Rph3a ( rabphilin 3A ) Rpl17 ( ribosomal protein L17 ) Rpl18 ( ribosomal protein L18 ) Rpl3 ( ribosomal protein L3 ) Rpl31 ( ribosomal protein L31 ) Rprm ( reprimo, TP53 dependent G2 arrest mediator candidate ) Rps24 ( ribosomal protein S24 ) Rps25 ( ribosomal protein S25 ) Rps6kb2 ( ribosomal protein S6 kinase, polypeptide 2 ) Rps7 ( ribosomal protein S7 ) Rraga ( Ras-related GTP binding A ) Rragd ( Ras-related GTP binding D ) Rreb1 ( ras responsive element binding protein 1 ) Rspo2 ( R-spondin 2 homolog (Xenopus laevis) ) Rspo3 ( R-spondin 3 homolog (Xenopus laevis) ) Rtn4 ( reticulon 4 ) Rtn4r ( reticulon 4 receptor ) Rtn4rl1 ( reticulon 4 receptor-like 1 ) Rufy3 ( RUN and FYVE domain containing 3 ) Runx1 ( runt related transcription factor 1 ) Runx1t1 ( CBFA2T1 identified gene homolog (human) ) Runx2 ( runt related transcription factor 2 ) Runx3 ( runt related transcription factor 3 ) Rxfp1 ( relaxin/insulin-like family peptide receptor 1 ) Rxfp3 ( relaxin family peptide receptor 3 ) Ryr1 ( ryanodine receptor 1, skeletal muscle ) Ryr2 ( ryanodine receptor 2, cardiac ) Ryr3 ( ryanodine receptor 3 ) S100a10 ( S100 calcium binding protein A10 (calpactin) ) Satb1 ( special AT-rich sequence binding protein 1 ) Satb2 ( special AT-rich sequence binding protein 2 ) Sca1 ( This is a duplicate entry for Atxn1 (Ataxin 1) ) Scand1 ( SCAN domain-containing 1 ) Scg2 ( secretogranin II ) Scg3 ( secretogranin III ) Scn1b ( sodium channel, voltage-gated, type I, beta ) Scn3b ( sodium channel, voltage-gated, type III, beta ) Scn4b ( sodium channel, type IV, beta ) Scnn1a ( sodium channel, nonvoltage-gated, type I, alpha ) Scrn1 ( secernin 1 ) Scrt1 ( scratch homolog 1, zinc finger protein (Drosophila) ) Scrt2 ( Scratch homolog 2 ) Scube1 ( signal peptide, CUB domain, EGF-like 1 ) Scube2 ( signal peptide, CUB domain, EGF-like 2 ) Sdc2 ( syndecan 2 ) Sdc3 ( syndecan 3 ) Sdcbp ( syndecan binding protein ) Sdha ( succinate dehydrogenase complex, subunit A, flavoprotein (Fp) ) Sebox ( SEBOX homeobox ) Selm ( selenoprotein M ) Sema3a ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A ) Sema3b ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B ) Sema3c ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C ) Sema3d ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D ) Sema3e ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E ) Sema3f ( sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F ) Sema4a ( sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A ) Sema4b ( sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B ) Sema5a ( sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A ) Sema6a ( sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A ) Sema6c ( sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C ) Sema6d ( sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D ) Sema7a ( sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A ) Senp2 ( SUMO/sentrin specific protease 2 ) Senp3 ( SUMO/sentrin specific protease 3 ) Sept3 ( septin 3 ) Sept4 ( septin 4 ) Sept5 ( septin 5 ) Sept6 ( septin 6 ) Sept7 ( septin 7 ) Sepw1 ( selenoprotein W, muscle 1 ) Serf1 ( small EDRK-rich factor 1 ) Serpina3c ( serine (or cysteine) peptidase inhibitor, clade A, member 3C ) Serpina3k ( serine (or cysteine) peptidase inhibitor, clade A, member 3K ) Serpina9 ( serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 ) Serpinb6a ( serine (or cysteine) peptidase inhibitor, clade B, member 6a ) Serpine2 ( Serpine2 serine (or cysteine) proteinase inhibitor, clade E, member 2 ) Serpinh1 ( serine (or cysteine) peptidase inhibitor, clade H, member 1 ) Serpini1 ( serine (or cysteine) peptidase inhibitor, clade I, member 1 ) Sertad4 ( SERTA domain containing 4 ) Sertm1 ( serine rich and transmembrane domain containing 1 ) Sez6 ( seizure related gene 6 ) Sez6l ( seizure related 6 homolog (mouse)-like ) Sez6l2 ( seizure related 6 homolog like 2 ) Sf1 ( splicing factor 1 ) Sfrp1 ( secreted frizzled-related protein 1 ) Sfrp2 ( secreted frizzled-related protein 2 ) Sfrp4 ( secreted frizzled-related protein 4 ) Sfrp5 ( secreted frizzled-related sequence protein 5 ) Sfrs1 ( splicing factor, arginine/serine-rich 1 (ASF/SF2) ) Sgsm1 ( small G protein signaling modulator 1 ) Sh3bgrl2 ( SH3 domain binding glutamic acid-rich protein like 2 ) Sh3bgrl3 ( SH3 domain binding glutamic acid-rich protein-like 3 ) Sh3kbp1 ( SH3-domain kinase binding protein 1 ) Shank3 ( SH3/ankyrin domain gene 3 ) Shf ( Src homology 2 domain containing F ) Shh ( sonic hedgehog ) Sim1 ( single-minded homolog 1 (Drosophila) ) Sipa1l1 ( signal-induced proliferation-associated 1 like 1 ) Sirpa ( signal-regulatory protein alpha ) Sirt2 ( sirtuin 2 (silent mating type information regulation 2, homolog) 2 (S. cerevisiae) ) Six3 ( sine oculis-related homeobox 3 ) Six6 ( sine oculis-related homeobox 6 ) Skil ( SKI-like ) Skor1 ( SKI family transcriptional corepressor 1 ) Skor1 ( SKI family transcriptional corepressor 1 ) Skor2 ( SKI family transcriptional corepressor 2 ) Sla ( src-like adaptor ) Slc10a4 ( solute carrier family 10 (sodium/bile acid cotransporter family), member 4 ) Slc12a5 ( solute carrier family 12, member 5 ) Slc13a3 ( solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 ) Slc16a3 ( solute carrier family 16 (monocarboxylic acid transporters), member 3 ) Slc17a6 ( solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 ) Slc17a7 ( solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 ) Slc17a8 ( solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 ) Slc18a2 ( solute carrier family 18 (vesicular monoamine), member 2 ) Slc18a3 ( solute carrier family 18 (vesicular monoamine), member 3 ) Slc1a1 ( solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 ) Slc1a2 ( solute carrier family 1 (glial high affinity glutamate transporter), member 2 ) Slc1a3 ( solute carrier family 1 (glial high affinity glutamate transporter), member 3 ) Slc1a6 ( solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 ) Slc20a1 ( solute carrier family 20, member 1 ) Slc20a2 ( solute carrier family 20, member 2 ) Slc22a3 ( solute carrier family 22 (organic cation transporter), member 3 ) Slc24a2 ( solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 ) Slc24a3 ( solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 ) Slc25a1 ( solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 ) Slc25a12 ( solute carrier family 25 (mitochondrial carrier, Aralar), member 12 ) Slc25a19 ( solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19 ) Slc25a22 ( solute carrier family 25 (mitochondrial carrier, glutamate), member 22 ) Slc25a4 ( solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 4 ) Slc27a2 ( solute carrier family 27 (fatty acid transporter), member 2 ) Slc29a1 ( solute carrier family 29 (nucleoside transporters), member 1 ) Slc30a3 ( solute carrier family 30 (zinc transporter), member 3 ) Slc32a1 ( solute carrier family 32 (GABA vesicular transporter), member 1 ) Slc33a1 ( solute carrier family 33 (acetyl-CoA transporter), member 1 ) Slc35f1 ( solute carrier family 35, member F1 ) Slc36a1 ( solute carrier family 36 (proton/amino acid symporter), member 1 ) Slc36a2 ( solute carrier family 36 (proton/amino acid symporter), member 2 ) Slc38a7 ( solute carrier family 38, member 7 ) Slc39a14 ( solute carrier family 39 (zinc transporter), member 14 ) Slc39a6 ( solute carrier family 39 (metal ion transporter), member 6 ) Slc41a3 ( solute carrier family 41, member 3 ) Slc4a2 ( solute carrier family 4 (anion exchanger), member 2 ) Slc5a7 ( solute carrier family 5 (choline transporter), member 7 ) Slc6a1 ( solute carrier family 6 (neurotransmitter transporter, GABA), member 1 ) Slc6a11 ( solute carrier family 6 (neurotransmitter transporter, GABA), member 11 ) Slc6a12 ( solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 ) Slc6a15 ( solute carrier family 6 (neurotransmitter transporter), member 15 ) Slc6a2 ( solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 ) Slc6a3 ( solute carrier family 6 (neurotransmitter transporter, dopamine), member 3 ) Slc6a4 ( solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 ) Slc6a5 ( solute carrier family 6 (neurotransmitter transporter, glycine), member 5 ) Slc6a6 ( solute carrier family 6 (neurotransmitter transporter, taurine), member 6 ) Slc6a7 ( solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 ) Slc6a9 ( solute carrier family 6 (neurotransmitter transporter, glycine), member 9 ) Slc7a14 ( solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 ) Slc8a2 ( solute carrier family 8 (sodium/calcium exchanger), member 2 ) Slc9a3r1 ( solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 ) Slco1c1 ( solute carrier organic anion transporter family, member 1c1 ) Slit1 ( slit homolog 1 (Drosophila) ) Slit2 ( slit homolog 2 (Drosophila) ) Slit3 ( slit homolog 3 (Drosophila) ) Slitrk1 ( SLIT and NTRK-like family, member 1 ) Slitrk2 ( SLIT and NTRK-like family, member 2 ) Slitrk3 ( SLIT and NTRK-like family, member 3 ) Slitrk4 ( SLIT and NTRK-like family, member 4 ) Slitrk5 ( SLIT and NTRK-like family, member 5 ) Slitrk6 ( SLIT and NTRK-like family, member 6 ) Smad4 ( MAD homolog 4 (Drosophila) ) Smad6 ( SMAD family member 6 ) Smarca5 ( SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 ) Smarcd2 ( SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 ) Smarce1 ( SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 ) Smn ( survival motor neuron ) Smo ( smoothened homolog (Drosophila) ) Smoc1 ( SPARC related modular calcium binding 1 ) Smoc2 ( SPARC related modular calcium binding 2 ) Smpd1 ( Sphingomyelin phosphodiesdterase 1 ) Smpd3 ( sphingomyelin phosphodiesterase 3, neutral ) Snap25 ( synaptosomal-associated protein 25 ) Snap91 ( synaptosomal-associated protein 91 ) Snca ( synuclein, alpha ) Sncb ( synuclein, beta ) Sncg ( synuclein, gamma ) Snhg11 ( small nucleolar RNA host gene 11 ) Snx17 ( sorting nexin 17 ) Snx5 ( sorting nexin 5 ) Soat2 ( sterol O-acyltransferase 2 ) Sobp ( sine oculis-binding protein homolog (Drosophila) ) Socs6 ( suppressor of cytokine ) Sod1 ( superoxide dismutase 1, soluble ) Soga2 ( SOGA family member 2 ) Sorbs1 ( sorbin and SH3 domain containing 1 ) Sorl1 ( sortilin-related receptor, LDLR class A repeats-containing ) Sort1 ( sortilin 1 ) Sostdc1 ( sclerostin domain containing 1 ) Sox1 ( SRY-box containing gene 1 ) Sox10 ( SRY-box containing gene 10 ) Sox11 ( SRY-box containing gene 11 ) Sox12 ( SRY-box containing gene 12 ) Sox14 ( SRY-box containing gene 14 ) Sox2 ( SRY-box containing gene 2 ) Sox3 ( SRY-box containing gene 3 ) Sox4 ( SRY-box containing gene 4 ) Sox5 ( SRY-box containing gene 5 ) Sox8 ( SRY-box containing gene 8 ) Sox9 ( SRY-box containing gene 9 ) Sp4 ( trans-acting transcription factor 4 ) Sp8 ( trans-acting transcription factor 8 ) Spag5 ( sperm associated antigen 5 ) Spag9 ( sperm associated antigen 9 ) Sparcl1 ( SPARC-like 1 ) Spata13 ( spermatogenesis associated 13 ) Sphkap ( SPHK1 interactor, AKAP domain containing ) Spint2 ( serine protease inhibitor, Kunitz type 2 ) Spock3 ( sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3 ) Spon1 ( spondin 1, (f-spondin) extracellular matrix protein ) Spp1 ( secreted phosphoprotein 1 ) Sprn ( shadow of prion protein ) Spry1 ( sprouty homolog 1 (Drosophila) ) Spry3 ( sprouty homolog 3 (Drosophila) ) Spry4 ( sprouty homolog 4 (Drosophila) ) Sptan1 ( spectrin alpha, non-erythrocytic 1 ) Sqle ( squalene epoxidase ) Srgap1 ( SLIT-ROBO Rho GTPase activating protein 1 ) Srgap2 ( SLIT-ROBO Rho GTPase activating protein 2 ) Srgap3 ( SLIT-ROBO Rho GTPase activating protein 3 ) Srr ( serine racemase ) Srsf5 ( serine/arginine-rich splicing factor 5 ) Srsf7 ( serine/arginine-rich splicing factor 7 ) Ssbp2 ( single-stranded DNA binding protein 2 ) Sst ( somatostatin ) Sstr1 ( somatostatin receptor 1 ) Sstr2 ( somatostatin receptor 2 ) Sstr3 ( somatostatin receptor 3 ) Sstr4 ( somatostatin receptor 4 ) Sstr5 ( somatostatin receptor 5 ) Ssx2ip ( synovial sarcoma, X breakpoint 2 interacting protein ) St3gal1 ( ST3 beta-galactoside alpha-2,3-sialyltransferase 1 ) St6galnac5 ( ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 ) St7 ( Suppression of tumorigenicity 7 ) St8sia2 ( ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 ) St8sia5 ( ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 ) Stard5 ( StAR-related lipid transfer (START) domain containing 5 ) Stard8 ( START domain containing 8 ) Stat3 ( signal transducer and activator of transcription 3 ) Stau1 ( staufen (RNA binding protein) homolog 1 (Drosophila) ) Stau2 ( staufen (RNA binding protein) homolog 2 (Drosophila) ) Steap2 ( six transmembrane epithelial antigen of prostate 2 ) Stk32a ( serine/threonine kinase 32A ) Stmn1 ( stathmin 1 ) Stmn2 ( stathmin-like 2 ) Stra6 ( stimulated by retinoic acid gene 6 ) Strip2 ( striatin interacting protein 2 ) Strn ( striatin, calmodulin binding protein ) Stt3b ( STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) ) Stx1a ( syntaxin 1A (brain) ) Stxbp2 ( syntaxin binding protein 2 ) Stxbp6 ( syntaxin binding protein 6 (amisyn) ) Styk1 ( serine/threonine/tyrosine kinase 1 ) Sucnr1 ( succinate receptor 1 ) Sufu ( suppressor of fused homolog (Drosophila) ) Sulf1 ( sulfatase 1 ) Sulf2 ( sulfatase 2 ) Sult1a1 ( sulfotransferase family 1A, phenol-preferring, member 1 ) Sun2 ( Sad1 and UNC84 domain containing 2 ) Susd2 ( sushi domain containing 2 ) Suv39h1 ( suppressor of variegation 3-9 homolog 1 (Drosophila) ) Sv2a ( synaptic vesicle glycoprotein 2 a ) Sv2b ( synaptic vesicle glycoprotein 2 b ) Sv2c ( synaptic vesicle glycoprotein 2c ) Svet1 ( subventricular expressed transcript 1 ) Svop ( SV2 related protein ) Syndig1l ( synapse differentiation inducing 1 like ) Syngap1 ( synaptic Ras GTPase activating protein 1 homolog (rat) ) Syngr3 ( synaptogyrin 3 ) Synj2 ( synaptojanin 2 ) Synpo ( synaptopodin ) Synpr ( synaptoporin ) Syt1 ( synaptotagmin 1 ) Syt10 ( synaptotagmin X ) Syt13 ( synaptotagmin XIII ) Syt16 ( synaptotagmin XVI ) Syt17 ( synaptotagmin XVII ) Syt2 ( synaptotagmin II ) Syt3 ( synaptotagmin III ) Syt4 ( synaptotagmin IV ) Syt5 ( synaptotagmin V ) Syt6 ( synaptotagmin VI ) Syt7 ( synaptotagmin VII ) Syt9 ( synaptotagmin IX ) Tac1 ( tachykinin 1 ) Tac2 ( tachykinin 2 ) Tacr1 ( tachykinin receptor 1 ) Tacr3 ( tachykinin receptor 3 ) Taf13 ( TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor ) Tagln3 ( transgelin 3 ) Tbc1d8 ( TBC1 domain family, member 8 ) Tbr1 ( T-box brain gene 1 ) Tbx3 ( T-box 3 ) TC1568100 ( TIGR MGI TC1568100 ) Tcf12 ( transcription factor 12 ) Tcf25 ( transcription factor 25 (basic helix-loop-helix) ) Tcf3 ( transcription factor 3 ) Tcf4 ( transcription factor 4 ) Tcf7l2 ( transcription factor 7-like 2, T-cell specific, HMG-box ) Tcrb ( T-cell receptor beta chain ) Tdo2 ( tryptophan 2,3-dioxygenase ) Tef ( thyrotroph embryonic factor ) Tesc ( tescalcin ) Tex261 ( testis expressed gene 261 ) Tfap2b ( transcription factor AP-2 beta ) Tfg ( Trk-fused gene ) Tfpi ( tissue factor pathway inhibitor ) Tgfb2 ( transforming growth factor, beta 2 ) Tgfb3 ( transforming growth factor, beta 3 ) Tgif1 ( TGFB-induced factor homeobox 1 ) Th ( tyrosine hydroxylase ) Thap4 ( THAP domain containing 4 ) Thbs1 ( thrombospondin 1 ) Thbs2 ( thrombospondin 2 ) Thbs3 ( thrombospondin 3 ) Thbs4 ( thrombospondin 4 ) Them6 ( thioesterase superfamily member 6 ) Thra ( thyroid hormone receptor alpha ) Thrap3 ( thyroid hormone receptor associated protein 3 ) Thrsp ( thyroid hormone responsive ) Thsd7a ( thrombospondin, type I, domain containing 7A ) Thsd7b ( thrombospondin, type I, domain containing 7B ) Thy1 ( thymus cell antigen 1, theta ) Tiam1 ( T-cell lymphoma invasion and metastasis 1 ) Tiam2 ( T-cell lymphoma invasion and metastasis 2 ) Timp2 ( tissue inhibitor of metalloproteinase 2 ) Tle1 ( transducin-like enhancer of split 1, homolog of Drosophila E(spl) ) Tle3 ( transducin-like enhancer of split 3, homolog of Drosophila E(spl) ) Tle4 ( transducin-like enhancer of split 4, homolog of Drosophila E(spl) ) Tll1 ( tolloid-like ) Tlx3 ( T cell leukemia, homeobox 3 ) Tm4sf20 ( transmembrane 4 L six family member 20 ) Tm9sf4 ( transmembrane 9 superfamily protein member 4 ) Tmeff1 ( transmembrane protein with EGF-like and two follistatin-like domains 1 ) Tmem145 ( transmembrane protein 145 ) Tmem163 ( transmembrane protein 163 ) Tmem16a ( transmembrane protein 16A ) Tmem16b ( transmembrane protein 16B ) Tmem178 ( transmembrane protein 178 ) Tmem20 ( transmembrane protein 20NM_175507.3 ) Tmem229b ( transmembrane protein 229B ) Tmem230 ( transmembrane protein 230 ) Tmem35 ( transmembrane protein 35 ) Tmem59l ( transmembrane protein 59-like ) Tnc ( tenascin C ) Tnfrsf12a ( tumor necrosis factor receptor superfamily, member 12a ) Tnfrsf19 ( tumor necrosis factor receptor superfamily, member 19 ) Tnip2 ( TNFAIP3 interacting protein 2 ) Tns1 ( tensin 1 ) Top2a ( topoisomerase (DNA) II alpha ) Tor1a ( torsin family 1, member A ) Tor1b ( torsin family 1, member B ) Tox ( thymocyte selection-associated high mobility group box ) Tpbg ( trophoblast glycoprotein ) Tpd52 ( tumor protein D52 ) Tpd52l1 ( tumor protein D52-like 1 ) Tph1 ( tryptophan hydroxylase 1 ) Tph2 ( tryptophan hydroxylase 2 ) Tpm1 ( tropomyosin 1, alpha ) Tppp3 ( tubulin polymerization-promoting protein family member 3 ) Traf4 ( TNF receptor associated factor 4 ) Trappc3 ( trafficking protein particle complex 3 ) Trf ( transferrin ) Trh ( thyrotropin releasing hormone ) Trhr ( thyrotropin releasing hormone receptor ) Trib2 ( tribbles homolog 2 (Drosophila) ) Trim2 ( tripartite motif-containing 2 ) Trim28 ( tripartite motif protein 28 ) Trim9 ( tripartite motif-containing 9 ) Trio ( triple functional domain (PTPRF interacting) ) Trnp1 ( TMF1-regulated nuclear protein 1 ) Trp73 ( Transformation related protein 73 ) Trpa1 ( transient receptor potential cation channel, subfamily A, member 1 ) Trpc2 ( transient receptor potential cation channel, subfamily C, member 2 ) Trpc4 ( transient receptor potential cation channel, subfamily C, member 4 ) Trpc6 ( transient receptor potential cation channel, subfamily C, member 6 ) Trpm8 ( transient receptor potential cation channel, subfamily M, member 8 ) Trps1 ( trichorhinophalangeal syndrome I (human) ) Trpv1 ( transient receptor potential cation channel, subfamily V, member 1 ) Trpv3 ( transient receptor potential cation channel, subfamily V, member 3 ) Trpv4 ( transient receptor potential cation channel, subfamily V, member 4 ) Tsc22d2 ( TSC22 domain family, member 2 ) Tsen34 ( tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae) ) Tspan11 ( tetraspanin 11 ) Tspan14 ( tetraspanin 14 ) Tspan7 ( tetraspanin 7 ) Ttc28 ( tetratricopeptide repeat domain 28 ) Ttc6 ( tetratricopeptide repeat domain 6 ) Ttr ( transthyretin ) Ttyh1 ( tweety homolog 1 (Drosophila) ) Tuba1b ( tubulin, alpha 1B ) Tubb3 ( tubulin, beta 3 class III ) Tubb4a ( tubulin, beta 4A class IVA ) Tubb4b ( tubulin, beta 4B class IVB ) Twist1 ( twist gene homolog 1 (Drosophila) ) Txnip ( thioredoxin interacting protein ) Tyro3 ( TYRO3 protein tyrosine kinase 3 ) Ubash3b ( ubiquitin associated and SH3 domain containing, B ) Ube2n ( ubiquitin-conjugating enzyme E2N ) Ube3a ( ubiquitin protein ligase E3A ) Ubn2 ( ubinuclein 2 ) Ubxn11 ( UBX domain protein 11 ) Uchl1 ( ubiquitin carboxy-terminal hydrolase L1 ) Ucn2 ( urocortin 2 ) Ucn3 ( urocortin 3 ) Ucp2 ( uncoupling protein 2 (mitochondrial, proton carrier) ) Uhmk1 ( U2AF homology motif (UHM) kinase 1 ) Ulk1 ( Unc-51 like kinase 1 (C. elegans) ) Unc5b ( unc-5 homolog B (C. elegans) ) Unc5c ( unc-5 homolog C (C. elegans) ) Unc5d ( unc-5 homolog D (C. elegans) ) Uncx ( UNC homeobox ) Uqcrc1 ( ubiquinol-cytochrome c reductase core protein 1 ) Uso1 ( USO1 vesicle docking factor ) Usp14 ( ubiquitin specific peptidase 14 ) Usp29 ( ubiquitin specific peptidase 29 ) Usp46 ( ubiquitin specific peptidase 46 ) Usp9x ( ubiquitin specific protease 9, X chromosome ) Vamp2 ( vesicle-associated membrane protein 2 ) Vat1 ( vesicle amine transport protein 1 homolog (T californica) ) Vav2 ( vav 2 oncogene ) Vax1 ( ventral anterior homeobox containing gene 1 ) Vb7904 ( Vb79b04.r1 ) Vcam1 ( vascular cell adhesion molecule 1 ) Vcan ( versican ) Vdac1 ( voltage-dependent anion channel 1 ) Vdac2 ( voltage-dependent anion channel 2 ) Vegfa ( vascular endothelial growth factor A ) Vgll2 ( vestigial like 2 homolog (Drosophila) ) Vim ( vimentin ) Vip ( vasoactive intestinal polypeptide ) Vipr2 ( vasoactive intestinal peptide receptor 2 ) Vldlr ( very low density lipoprotein receptor ) Vmn1r206 ( vomeronasal 1 receptor 206 ) Vps13a ( vacuolar protein sorting 13A (yeast) ) Vsnl1 ( visinin-like 1 ) Vsx2 ( visual system homeobox 2 ) Wasf1 ( WAS protein family, member 1 ) Wbscr17 ( Williams-Beuren syndrome chromosome region 17 homolog (human) ) Wdr1 ( WD repeat domain 1 ) Wdr13 ( WD repeat domain 13 ) Wdr46 ( WD repeat domain 46 ) Wdr74 ( WD repeat domain 74 ) Wfs1 ( Wolfram syndrome 1 homolog (human) ) Whrn ( whirlin ) Wif1 ( Wnt inhibitory factor 1 ) Wnk1 ( WNK lysine deficient protein kinase 1 ) Wnt1 ( wingless-related MMTV integration site 1 ) Wnt2b ( wingless related MMTV integration site 2b ) Wnt3 ( wingless-related MMTV integration site 3 ) Wnt3a ( wingless-related MMTV integration site 3A ) Wnt5a ( wingless-related MMTV integration site 5A ) Wnt5b ( wingless-related MMTV integration site 5B ) Wnt7a ( wingless-related MMTV integration site 7A ) Wnt7b ( wingless-related MMTV integration site 7B ) Wnt8b ( wingless related MMTV integration site 8b ) Wnt9b ( wingless-type MMTV integration site 9B ) Wrb ( tryptophan rich basic protein ) Wscd1 ( WSC domain containing 1 ) Wwc1 ( WW, C2 and coiled-coil domain containing 1 ) Xk ( Kell blood group precursor (McLeod phenotype) homolog ) Xpo4 ( exportin 4 ) Yjefn3 ( YjeF N-terminal domain containing 3 ) Ypel4 ( yippee-like 4 (Drosophila) ) Ywhah ( tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide ) Ywhaz ( tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide ) Zbtb18 ( zinc finger and BTB domain containing 18 ) Zbtb20 ( zinc finger and BTB domain containing 20 ) Zcchc12 ( zinc finger, CCHC domain containing 12 ) Zdbf2 ( zinc finger, DBF-type containing 2 ) Zdhhc2 ( zinc finger, DHHC domain containing 2 ) Zdhhc7 ( zinc finger, DHHC domain containing 7 ) Zeb2 ( zinc finger E-box binding homeobox 2 ) Zfhx3 ( zinc finger homeobox 3 ) Zfp385 ( zinc finger protein 385 ) Zfp503 ( zinc finger protein 503 ) Zfp521 ( zinc finger protein 521 ) Zfp532 ( zinc finger protein 532 ) Zfp618 ( zinc fingerprotein 618 ) Zfp804a ( zinc finger protein 804A ) Zfp90 ( zinc finger protein 90 ) Zfpm2 ( zinc finger protein, multitype 2 ) Zic1 ( zinc finger protein of the cerebellum 1 ) Zic2 ( zinc finger protein of the cerebellum 2 ) Zic3 ( zinc finger protein of the cerebellum 3 ) Zic4 ( zinc finger protein of the cerebellum 4 ) Zic5 ( zinc finger protein of the cerebellum 5 ) Zik1 ( zinc finger protein interacting with K protein 1 ) Zim1 ( zinc finger, imprinted 1 ) Zmat4 ( zinc finger, matrin type 4 ) Zmynd11 ( zinc finger, MYND domain containing 11 ) Zscan12 ( zinc finger and SCAN domain containing 12 ) Zwint ( ZW10 interactor ) Zyx ( zyxin )

Access level: Public Access

Enter pw for higher access level: